Reticulitermes flavipes

Sample information

Picture
Entry by: Nithin S.
Location
Approximate location: 33.99, -84.44
Collection date 11/07/2025
Captive / Cultivated? Wild-caught
Group Walton High School
Observations

The termites are constantly moving and are usually in groups. The termites seem to respond to sounds or vibrations of the container they are in.

Putative identification Arthropoda Insecta Blattodea Rhinotermitidae Reticulitermes Reticulitermes flavipes

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TAE
DNA stain GelGreen
Gel images
Protocol notes

I took multiple termites, as I didn’t believe that 1 termite gave enough DNA. Then we centrifuged to separate the body and cells. Then we extracted strictly only the DNA. Now we are working on PCR. Took the extracted DNA and ran it through Gel electrophoresis. The first screenshot is the result of the Wolbachia gel, and the second screenshot is the gel for the arthropod results.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

Due to there being no banding for Wolbachia in the gel results, I can confidently say that this organism is negative for Wolbachia.

Wolbachia 16S sequence Download FASTA   
Arthropod COI sequence Download FASTA    Download AB1
TTCNGGTGCCTGATCAGGATGGTCGGAACATCACTTAGAATACTAATTCGAACAGAACTAGGGCAACCCGGATCTCTAATTGGAGATGACCAGATCTACAACGTTATCGTTACTGCTCATGCATTCGTCATAATTTTCTTTATAGTCATACCAATCATGATTGGTGGATTCGGAAACTGATTAGTACCACTTATATTAGGAGCCCCAGACATGGCATTCCCACGAATAAACAACATAAGATTTTGATTACTCCCACCGTCATTAACATTACTACTTACTAGCAGAACAGTAGAAAGTGGAGCAGGGACAGGATGAACAGTCTACCCCCCTCTTGCGAGAGGTATTGCCCATGCAGGAGCATCCGTAGACTTAGCCATCTTCTCCTTACATCTAGCAGGTGTTTCATCAATTTTGGGAGCAGTAAATTTTATCTCAACAACAATTAACATAAAACCAAAAAATATAAAACCCGAACGAATTCCACTATTCGTATGATCAGTCGCCATCACAGCTCTACTCCTACTATTATCCCTGCCAGTACTAGCCGGAGCAATCACTATGTTATTAACCGACCGCAACCTAAATACATCATTCTTTGACCCAGCTGGAGGTGGAGACCCAATCCTATATCAACACTTATTCTGATTTTTNG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Reticulitermes flavipes was found to be negative for Wolbachia.
Report Inappropriate Post