Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/07/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Walton High School |
| Observations | The termites are constantly moving and are usually in groups. The termites seem to respond to sounds or vibrations of the container they are in. |
| Putative identification | Arthropoda Insecta Blattodea Rhinotermitidae Reticulitermes Reticulitermes flavipes |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | 1X TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | I took multiple termites, as I didn’t believe that 1 termite gave enough DNA. Then we centrifuged to separate the body and cells. Then we extracted strictly only the DNA. Now we are working on PCR. Took the extracted DNA and ran it through Gel electrophoresis. The first screenshot is the result of the Wolbachia gel, and the second screenshot is the gel for the arthropod results. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Due to there being no banding for Wolbachia in the gel results, I can confidently say that this organism is negative for Wolbachia. |
| Wolbachia 16S sequence | Download FASTA
|
| Arthropod COI sequence | Download FASTA
Download AB1
TTCNGGTGCCTGATCAGGATGGTCGGAACATCACTTAGAATACTAATTCGAACAGAACTAGGGCAACCCGGATCTCTAATTGGAGATGACCAGATCTACAACGTTATCGTTACTGCTCATGCATTCGTCATAATTTTCTTTATAGTCATACCAATCATGATTGGTGGATTCGGAAACTGATTAGTACCACTTATATTAGGAGCCCCAGACATGGCATTCCCACGAATAAACAACATAAGATTTTGATTACTCCCACCGTCATTAACATTACTACTTACTAGCAGAACAGTAGAAAGTGGAGCAGGGACAGGATGAACAGTCTACCCCCCTCTTGCGAGAGGTATTGCCCATGCAGGAGCATCCGTAGACTTAGCCATCTTCTCCTTACATCTAGCAGGTGTTTCATCAATTTTGGGAGCAGTAAATTTTATCTCAACAACAATTAACATAAAACCAAAAAATATAAAACCCGAACGAATTCCACTATTCGTATGATCAGTCGCCATCACAGCTCTACTCCTACTATTATCCCTGCCAGTACTAGCCGGAGCAATCACTATGTTATTAACCGACCGCAACCTAAATACATCATTCTTTGACCCAGCTGGAGGTGGAGACCCAATCCTATATCAACACTTATTCTGATTTTTNG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Reticulitermes flavipes was found to be negative for Wolbachia. |




North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat