Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/07/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Walton High School |
| Observations | Rolls up after any danger type taxis. Moves at a slow pace. Body is gray with white stripes. |
| Putative identification | Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | 1X TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | Crushed the full organism, as it was about the size of a rice grain, and cutting the abdomen would have been very difficult. We then centrifuged and only extracted DNA. Took the extracted DNA and ran it through Gel Electrophoresis. Results yielded that there was no Wolbachia in this organism. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I am able to confidently say that this organism is Wolbachia negative due to there being no banding in the Wolbachia gel meaning that there is not wolbachia DNA in that organism. |
| Wolbachia 16S sequence | Download FASTA
|
| Arthropod COI sequence | Download FASTA
Download AB1
TTGAGCAGGGGCTGTTGGAACTGCCCTTAGAATAATTATTCGCACTGAATTAGGACAACCTGGAAGTTTAATTGGAGATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATGGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTGCTTAGAAGTGGGTTGGTTGAAAGAGGAGTAGGAACAGGATGGACAGTATATCCTCCGCTGGCGTCTAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTGAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTATTAGTAACGGCTGTACTTTTACTTTTATCCCTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGGGGAGGAGGAGACCCTATCCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGGAAGTTTAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Armadillidium vulgare was found to be negative for Wolbachia. |




North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat