NV1- Euborellia arcanum (Earwig)

Sample information

Picture
Entry by: NihalV
Location
Collection date 11/10/2025
Captive / Cultivated? Wild-caught
Group Walton High School
Observations

The arthropod was found under a pot in the garden where it was attempting to burrow in damp, moist soil. The arthropod was found deep in the soil, not on the surface. The arthropod was moving very quickly on its appendage when trying to burrow in the soil. When the arthropod was in the collection container, it tried to hide in the dirt in the container. When agitating the container the arthropod moved around very quickly and even tried climbing up the walls. The arthropod has a rod like shape from the thorax to abdomen that is primarily black/dark brown with red coloration around the end of the abdomen. The head of the arthropod has antennae, while the end of it has a red, prong like structure. The thorax of the arthropod has 3 thin appendages one each side of the body.

Putative identification Arthropoda Insecta Dermaptera Anisolabididae Euborellia Euborellia arcanum

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TAE
DNA stain GelGreen
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

We were very confident in our results because for the Arthropod gel our controls for the PCR positive and control positive showed bands meaning the PCR and purification worked. For the Wolbachia gel, our only bands that appeared were the PCR positive and control positive meaning that both the extraction/purification and PCR worked. Since the PCR and extraction worked and we did not see bands in our samples then we are confident none of our samples have the Wolbachia DNA in them.

Wolbachia 16S sequence Download FASTA   
Arthropod COI sequence Download FASTA    Download AB1
TGGGGCTTGATCGGGGNNGGTAGGAACTAATTTGAGAATTTTAATTCGAACAGAGTTAGGTCAGCCTGGATCTTTAATTGGAGATGATCAGATTTATAATGTTATTGTTACTGCTCACGCTTTTATTATAATTTTTTTTATGGTAATGCCAATTATAATTGGAGGGTTTGGTAATTGATTAGTTCCTTTAATATTGAGAGCTCCAGATATAGCTTTCCCACGAATGAATAATATAAGATTTTGGTTATTACCTCCATCTCTGATTTTATTATTATCAGGGGGCCTAGTAGATAGAGGGGCTGGGACAGGTTGGACAGTGTATCCTCCTTTATCATCAGTGATTTCTCATGGAGGGGCTTCAGTGGATATAACTATTTTTTCTTTACATTTGGCAGGGGTTTCTTCTATTTTGGGAGCCATTAATTTTATTACTACTGTGATTAATATACGTCCAGAAGGTTTAAAGCTTGATCGTGTTCCTTTATTTGTTTGATCAGTAGCTATTACTGCTTTATTATTATTGCTTTCTTTACCGGTTTTAGCAGGAGCTATTACGATATTATTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCCGGAGGCGGAGATCCTATTTTATATCAACATTTATTTTGATTTTTNG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Euborellia arcanum was found to be negative for Wolbachia.
Report Inappropriate Post