NV2- Tenebrio molitor (Yellow mealworm)

Sample information

Picture
Entry by: NihalV
Location
Collection date 11/13/2025
Captive / Cultivated? Captive / Cultivated
Group Walton High School
Observations

Since this arthropod is a cultured mealworm, it was found in a box that had oats and other nutritious substances/material. The mealworm was also found among many other mealworms and super worms. The arthropod moves very slowly with the front end of the arthropod moving followed by the behind. The arthropod moves on its 6 very small appendages at the front of the body. When in the collection container and agitated the arthropod thrashes around slowly. The arthropod has a very uniform shape with a tannish, beige coloration. There are 6 small appendages on the posterior first 1/4 length of the body. The front of the arthropod has a brownish color that is flat in shape. The arthropod also has multiple scale like partitionings on the anterior side of the body.

Putative identification Arthropoda Insecta Coleoptera Tenebrionidae Tenebrio Tenebrio molitor

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TAE
DNA stain GelGreen
Gel images
Protocol notes

Remove the abdomen from the mealworm which is the last 3/4 of the mealworm. Place the abdomen in the microcentrifuge tube, add in the buffer and grind vigorously with the pestle until the body is in the solution. Add in the other buffers step by step to perform the purification. When DNA is purified after being poured into column, elute the column.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

We were very confident in our results because for the Arthropod gel our controls for the PCR positive and control positive showed bands meaning the PCR and purification worked. For the Wolbachia gel, our only bands that appeared were the PCR positive and control positive meaning that both the extraction/purification and PCR worked. Since the PCR and extraction worked and we did not see bands in our samples then we are confident none of our samples have the Wolbachia DNA in them.

Wolbachia 16S sequence Download FASTA   
Arthropod COI sequence Download FASTA    Download AB1
TGNAGCGTGATCCGGAATAGTCGGAACCTCCCTAAGACTATTAATCCGTGCAGAATTAGGAAACCCCGGCTCTTTAATTGGGGACGACCAAATCTACAACGTAATTGTTACAGCACATGCTTTTATCATAATTTTTTTCATAGTAATACCAATCATAATTGGAGGATTCGGAAATTGATTGGTACCTCTAATACTAGGCGCTCCTGACATAGCATTCCCACGAATAAACAACATAAGATTCTGATTGCTACCCCCTTCACTAAGACTATTATTAATAAGAAGAATTGTAGAAAACGGGGCGGGAACCGGTTGAACAGTTTATCCGCCCTTATCCTCTAATATCGCCCACGGGGGAGCATCTGTCGATTTAGCAATTTTCAGGCTACATCTAGCAGGGATTTCATCAATCCTGGGGGCCGTAAATTTTATTACAACAGTAATCAACATACGACCACAGGGCATAACGTTCGATCGAATACCGTTATTCGTGTGAGCAGTAGTAATTACCGCAGTACTATTATTATTATCCTTGCCAGTATTAGCAGGAGCCATTACCATATTACTTACAGATCGAAACATTAATACATCCTTCTTTGACCCAGCTGGGGGAGGAGACCCAATCTTATACCAACACCTATTCTGATTTTTTGGTCAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Tenebrio molitor was found to be negative for Wolbachia.
Report Inappropriate Post