Armadillidium vulgare

Sample information

Picture
Entry by: Soren P.
Location
Approximate location: 42.18, -73.44
Collection date 09/30/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

Area around the specimen was damp, but the specimen was on a pretty dry flat rock.

It was collected at 9:30pm, just off the road, in a big agricultural field.

 

Putative identification Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010).

The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C.

Details that differed from the written protocol (incubation time differences, accidental mistakes, etc.) were:

  1. The proper quantity of the sample used for extraction was specified in the protocol as being smaller than a grain of rice. I accidentally used roughly 1.5x that amount.
  2. The protocol called for an incubation time of anywhere from 30-60 minutes, with times such as 2-3 hours being ideal. I only incubated mine for ~30 minutes. While 30 minutes should be long enough, as stated in the protocol, it would have been beneficial to incubate for longer.

Our first PCR reaction was set up on 10/15/2025 and was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16S primers together.

We used an annealing temperature of 49 degrees Celsius.

We used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S).

Differed from the written protocol?

  • Our total amount of Taq Master Mix for the 7 reactions was 88ul, not 87.5ul. This was due to our micropipette not being able to measure out decimals, so we had to round up to 88ul.

Our first Gel image was taken on 10/22/2025 and:

  • Was run at 125 volts for 20 minutes.
  • Used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S).

Our second PCR reaction was set up on 10/29/2025, used the same Taq polymerase as the first PCR reaction, and was a duplex reaction that used the Arthropod CO1_F&R and Wolbachia 16S_F&R primers.

  • We used an annealing temperature of 49ºC.
  • Differed from the standard protocol in that I used 2.5uL of template DNA from my sample instead of using 2.0uL like the protocol calls for. To ensure that all of the PCR tubes contained the proper total volume of 25uL (DNA + PCR cocktail), I added the water to each PCR tube separate from the PCR cocktail. The PCR cocktail contained no water. Every control received 2.5uL of water, along with the proper 2.0uL of template DNA. My sample received 2.0uL of water, along with the increased 2.5uL of template DNA. The total volume of PCR cocktail added to each tube was 20.5uL.

Our second Gel image was taken on 11/5/2025 and was run at 125 volts for 21 minutes.

  •  Used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S).

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level
  • My (-)Water control showed its expected result with no bands present.
  • The (+)Arthropod Control showed its expected results with two bands, roughly 708bp and 438bp.
  • The (-)Arthropod Control showed its expected results with a single band roughly 708bp.
  • The (+)DNA Control also showed its expected results with two bands, roughly 708bp and 438bp.

All the controls worked as expected. My sample (2-SP), however, showed no results, therefore I cannot determine whether my sample (2-SP) has Wolbachia, or not. This is why I have selected Unknown as my result.

In the second Gel image taken on 11/5/2025 all results for the controls were as expected (same results as the first gel), but this time, my sample’s lane has a distinct band roughly 708bp, indicating that my sample (2-SP) contains arthropod DNA, but not Wolbachia DNA. Since all controls had the proper results, and the sample now shows the presence of Arthropod DNA, I am somewhat confident that my sample is negative for Wolbachia. The reason I am not highly confident is because my sample did not show any results until I increased the template DNA amount and ran another duplex PCR. The level of Wolbachia, if present, could still be too little to detect.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
GAGCAGGGGCTGTTGGGACTGCTCTTAGAATAATTATTCGCACTGAATTAGGACAACCTGGAAGTTTAATTGGAGATGATCAGATTTATAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTCGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTCTTACCCCCTTCTTTAACTTTATTACTGAGAAGGGGATTAGTTGAAAGAGGAGTAGGAACAGGGTGAACAGTGTATCCTCCGCTGGCGTCAAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCCTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTAATAGTAACGGCTGTACTTTTACTTTTATCATTACCTGTATTAGCAGGAGCTATTACTATATTATTGACTGATCGAAATTTAAATACATCTTTTTTTGACCCTAGAGGAGGGGGGGATCCTGTCCTTTATCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Armadillidium vulgare was found to be negative for Wolbachia.
Report Inappropriate Post