Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2025 students. The field method used was a killing jar. The habitat in which the insect was caught was on a flowering plant. |
| Putative identification | Arthropoda Insecta Hymenoptera Apidae Bombus Bombus impatiens |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
AATAAAGGAACACGGTCTATTCTAATTCCAGCTGCTCGTATATTAATTATAGTAGTAATAAAATTCACAGCCCCTAAAAT AGAAGAAGCTCCAGCAAGGTGGAGAGAAAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Bombus impatiens was found to be negative for Wolbachia. |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1