Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/05/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Auburn University at Montgomery |
| Observations | Small/ medium sized; chunky, furry Mostly black with black and yellow stripped bottom Found in grassland area ontop of a flower |
| Putative identification | Arthropoda |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | 1X TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | Single PCR reactions were performed for arthropod CO1 and Wolbachia 16S rRNA amplification following Wolbachia Project protocols. DNA extraction was completed using the Qiagen DNeasy Blood and Tissue Kit. Gel electrophoresis was performed using the MiniOne Electrophoresis System with TBE running buffer and GelGreen stain. The arthropod CO1 gene amplified successfully and BLAST analysis identified the specimen as Habropoda laboriosa (southeastern blueberry bee). No Wolbachia 16S rRNA band was detected, suggesting the specimen was not infected with Wolbachia. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | I have moderate confidence in my results because, I did not get to use controls, so I cannot fully confirm that the Wolbachia PCR worked perfectly or rule out all possible contamination or PCR issues. Since no Wolbachia 16S band was detected, my sample most likely did not have detectable Wolbachia, but my confidence is not high because controls were not included. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AACTTCTTTGAGTATAATTATTCGTATGGAGTTGAGTAGTCCTGGGATATGAATTAATAATGATCAAATTTATAATTCTATTGTGACTGCTCATGCTTTTATAATAATTTTTTTTATGGTTATACCATTTATAATTGGTGGTTTTGGTAATTGGTTGGTTCCTTTAATGATTGGATCTCCTGACATAGCTTTTCCTCGTATAAATAATATTAGGTTTTGATTACTTCCTCCTTCTTTAATTTTATTAATTATAAGTAATTTATTTCAAGTTAGGCCTGGTACTGGATGAACGGTTTATCCTCCTTTATCTTCTTATATATTTCATTCTTCACCTTCGGTTGATTTTACTATTTTTTCTTTACATATATCAGGGATGTCATCTATTATGGGGGCTATGAATTTTATAGTTACTATTATGTTGATGAAGAATTTTTCAGTTAAGTATGATTTTTTGCCTTTATTTGCTTGGTCGGTATTTATTACAGCTATTTTATTATTGTTATCTTTACCTGTTTTAGCTGGAGCGATTACTATACTTCTTTTTGATCGTAATATTAATACTTCTTTTTTTGATCCTTTAGGAGGGGGGGATCCTATTTTATATCAACATTTATTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Arthropoda was found to be negative for Wolbachia. |



North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat