YSD1

Sample information

Picture
Entry by: Yesenia D
Location
Collection date 03/05/2026
Captive / Cultivated? Wild-caught
Group Auburn University at Montgomery
Observations

Small/ medium sized; chunky, furry

Mostly black with black and yellow stripped bottom

Found in grassland area ontop of a flower

Putative identification Arthropoda

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer 1X TBE
DNA stain GelGreen
Gel images
Protocol notes

Single PCR reactions were performed for arthropod CO1 and Wolbachia 16S rRNA amplification following Wolbachia Project protocols. DNA extraction was completed using the Qiagen DNeasy Blood and Tissue Kit. Gel electrophoresis was performed using the MiniOne Electrophoresis System with TBE running buffer and GelGreen stain. The arthropod CO1 gene amplified successfully and BLAST analysis identified the specimen as Habropoda laboriosa (southeastern blueberry bee). No Wolbachia 16S rRNA band was detected, suggesting the specimen was not infected with Wolbachia.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

I have moderate confidence in my results because, I did not get to use controls, so I cannot fully confirm that the Wolbachia PCR worked perfectly or rule out all possible contamination or PCR issues. Since no Wolbachia 16S band was detected, my sample most likely did not have detectable Wolbachia, but my confidence is not high because controls were not included.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AACTTCTTTGAGTATAATTATTCGTATGGAGTTGAGTAGTCCTGGGATATGAATTAATAATGATCAAATTTATAATTCTATTGTGACTGCTCATGCTTTTATAATAATTTTTTTTATGGTTATACCATTTATAATTGGTGGTTTTGGTAATTGGTTGGTTCCTTTAATGATTGGATCTCCTGACATAGCTTTTCCTCGTATAAATAATATTAGGTTTTGATTACTTCCTCCTTCTTTAATTTTATTAATTATAAGTAATTTATTTCAAGTTAGGCCTGGTACTGGATGAACGGTTTATCCTCCTTTATCTTCTTATATATTTCATTCTTCACCTTCGGTTGATTTTACTATTTTTTCTTTACATATATCAGGGATGTCATCTATTATGGGGGCTATGAATTTTATAGTTACTATTATGTTGATGAAGAATTTTTCAGTTAAGTATGATTTTTTGCCTTTATTTGCTTGGTCGGTATTTATTACAGCTATTTTATTATTGTTATCTTTACCTGTTTTAGCTGGAGCGATTACTATACTTCTTTTTGATCGTAATATTAATACTTCTTTTTTTGATCCTTTAGGAGGGGGGGATCCTATTTTATATCAACATTTATTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Arthropoda was found to be negative for Wolbachia.
Report Inappropriate Post