GRP1 Argentine Ant(Linepithema humile) – Sample #2 | Carson, California 90746

Sample information

Picture
Entry by: Sok S.
Location
Approximate location: 33.86, -118.25
Collection date 04/24/2026
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

Caught outside classroom around 9:00 am near some bushes. There were many more ants present in the same area.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Linepithema Linepithema humile

Methods

Extraction kit Edwards Buffer
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain UView
Gel images
Protocol notes

DNA Stain

We used a UV stain and let it stain for the duration of our gel electrophoresis run.

Gel Electrophoresis

10 microliters of sample were added per well for this 1% agarose gel.

This is the lane order for the gel:

1. DNA Ladder

2. Positive Control

3. Positive DNA Control

4. Negative Control

5. Ant Sample 1

6. Ant Sample 2 – This one

7. Ant Sample 3

8. Water

Results

Wolbachia presence Unknown
Confidence level High
Explanation of confidence level

We present high confidence in the fact that we don’t know if Wolbachia was present or not as there was a distinct band present in the negative control lane for the arthropod-specific gene and nothing for the Wolbachia. This lets us know that there was a mishap that occurred during the execution of our procedure, so we cannot draw any conclusions confidently.

Wolbachia 16S sequence Download FASTA    Download AB1
NNNNNNNNNNNNNNNNAGNNNNNNNGNNTGCNCNNCTCTTGTCTNGATATNTTTTGTTATTTCTTTTTCGAGCGCCCCCT NNTCCATANTTACCATCAAGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGT CAAGTCATCTTGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAGGCTA ANCTAATCCCTTAAAACCCATCTCANTTCGGATTGTACTCTGCAACTCNAGTGCATGAAGTTGGAATCGCTAGTAATCCT GGATCANCACGCCACGGTGAATACGTTCTCGGGTCTTGTACCCACTGCCCGTCTCGCCATGGGAATTGGTTTCCCTCNAA GCTANNN
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary
Report Inappropriate Post