Lasius americanus Woodland Fuzzy Ant | Annandale, Virginia

Sample information

Picture
Entry by: Tristan P.
Location
Collection date 04/22/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

Found underneath a fallen tree log, along with the ant colony. In short time did most of the larvae and the ants enter the ground. Explored nearby stream region next to school.

 

PCR Gel Image results, from left to right of the top row:
sample 571, 572, 573 (this entry), 574, Positive Wolbachia Drosophila, Negative Wolbachia Drosophila, PC DNA, Water, Ladder

The bottom row was for the same samples, but for Wolbachia primers. from left to right of the bottom row:
sample 571, 572, 573 (this entry), 574, Ladder, Positive Wolbachia Drosophila, Negative Wolbachia Drosophila, PC DNA, Water

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius americanus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain SYBR Safe
Gel images
Protocol notes

Primers to specifically amplify a 438-bp (base pair) fragment of the 16S ribosomal RNA gene (ubiquitous in all Wolbachia) are: 

Wolbachia_F (16S_WspecF): 5’−CAT ACC TAT TCG AAG GGA TAG−3’  and 

Wolbachia_R (16S_WspecR): 5’−AGC TTC GAG TGA AAC CAA TTC−3’.  

When using these primers, the ideal annealing temperature is 55°C.

 

Primers to specifically amplify a 708-bp fragment of the CO1 cytochrome oxidase gene (ubiquitous in arthropod mitochondria) are: 

Arthropod_F (LCO1490): 5’−GGT CAA CAA ATC ATA AAG ATA TTG G−3’  and 

Arthropod_R (HCO2198): 5’−TAA ACT TCA GGG TGA CCA AAA AAT CA−3’.  

When using these primers, the ideal annealing temperature is 49°C.

DNA extraction had 260/280 ratio of 1.712,
and Nucleic acid density (ng/uL) was originally 602.163. We had to dilute down to ~ 50 ng/uL before sending to sequence.

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

A 30 cycle PCR along with 16S rRNA primers for Wolbachia + SYBR Safe did not show any glow or presence of DNA for any of our extracted samples. But our Supposed Positive Wolbachia Arthropod sample from D. melanogaster in the PCR Gel Electrophoresis results also did not show any glow or presence of DNA, meaning likely something went wrong with Wolbachia testing specific DNA amplification. The predicted result of the Positive Control DNA convolutes the reason for the error more, since that hints that PCR steps were generally correct.
We suspect that there was a sample specific error on the Positive Wolbachia Arthropod, maybe forgetting to insert the primers into that tube only, etc. Because we are unsure, we are not highly confident Wolbachia was not present in all of our samples.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
CTNTTTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTTACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGGCGATCCTATTTTATATCAACATCTTTTCTGATTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius americanus was found to be negative for Wolbachia.
Report Inappropriate Post