Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/22/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Thomas Jefferson High School for Science and Technology |
| Observations | Organism was collected from an ant nest under an unearthed log in April. Many ants were nearby, multiple were extracted, then this sample was randomly selected. Organism was small, so full organism was processed. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius alienus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | 1X TBE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | DNA extraction: whole arthropod was crushed thoroughly with a pestle until fully solvent. Exoskeleton was negligible due to size. Gel electrophoresis lanes, top (CO1): 1 – empty 2 – other sample 3 – other sample 4 – other sample 5 – Lasius alienus sample 6 – Positive drosophila control 7 – Negative drosophila control 8 – Positive DNA control 9 – water 10 – 1kB ladder Gel electrophoresis lanes, bottom (qPCR for wolbachia 16S rRNA gene) : 1 – empty 2 – other sample 3 – other sample 4 – other sample 5 – Lasius alienus sample 6 – 1kB ladder 7 – Positive drosophila control 8 – Negative drosophila control 9 – Positive DNA control 10 – water |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Although the Wolbachia-positive DNA control showed a band for the 16s rRNA Wolbachia gene and CO1, the positive control drosophila only showed a band for CO1. This could have resulted from a variety of errors. First, the positive control may not have actually been positive. Second, the DNA extraction could have recovered the host DNA successfully but very little bacterial DNA. Third, some PCR inhibitors could have wiped out Wolbachia DNA while the more abundant CO1 DNA remained. Fourth, Wolbachia titer may be too low in that fly DNA prep. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GCTATTTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTTACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGGCGATCCTATTTTATATCAACATCTTTTCTGATTTTTTGGNCAC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Lasius alienus was found to be negative for Wolbachia. |


Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)
(no title)