Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/25/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | This Xysticus ferox was found on a rocky trail directly next to a suburban forest at the Pingry School in Basking Ridge, NJ. The specimen was resting on the ground, near the edge of the path, next to plants. |
| Putative identification | Arthropoda Arachnida Araneae Thomisidae Xysticus Xysticus ferox |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | agarose gel electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | The experiment began with the extraction of DNA from the Xysticus ferox. To confirm DNA presence, a nanodrop was used, and the nanodrop found a concentration of 126.8 uL/ng. PCR was performed to amplify the Arthropod and possible Wolbachia DNAs. Following PCR, gel electrophoresis was run to determine the success of the previous protocols and to show expression of the DNA. In the end, the experiment found that the Xysticus ferox did not have Wolbachia. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | In the top of the gel in lane 2, the gel showed no Wolbachia DNA in the specimen. Furthermore, the arthropod-positive and Wolbachia-positive DNA control fragments appeared on the gel (Bottom & Top of gel, respectively, Lane 3), as well as the Xysticus ferox arthropod DNA fragments (Bottom of gel, Lane 2), indicating that the protocols were correctly followed. However, the arthropod gene sequencing for the specimen did not exactly match any other previous submission. Yet, the sequence had a 98% match rate in comparison to a previously entered Xysticus ferox from a reliable inputter. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
TGGAGCTTGATCAGCTATAGTTGGGACTGCAATAAGAGTTTTAATTCGTATAGAGTTAGGAAATGTGGGTAGATTATTAGGGGATGATCATTTGTATAATGTAATTGTTACAGCTCATGCTTTTGTAATGATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCTTTTTGGTTACTCCCTCCTTCATTATTTTTATTATTTATATCATCTATAGTAGAAATAGGTGTCGGGGCTGGTTGAACTGTTTATCCTCCTTTAGCGTCTAGTATAGGGCATATAGGAAGATCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCAGGTGCTTCATCAATTATAGGAGCTGTTAATTTTATTTCAACAATTATTAATATACGTGTAGTTGGTATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCTGTTTTAGTGACAGCTATTTTACTTCTTTTATCTTTACCTGTTTTAGCAGGGGCTATTACAATATTACTTACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATTTCAACATTTATTTTGATTTTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Xysticus ferox was found to be negative for Wolbachia. |


Potter’s grass spider (Agelenopsis Potteri)
Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)