Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/14/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | The insect was sitting on a lead of a beech |
| Putative identification | Arthropoda Insecta Hemiptera Rhyparochromidae Rhyparochromus Rhyparochromus pini |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | Fast Blast |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | there is one band on he gel. So it could be a sign of Wolbachia. It isn’t clear yet if it is the Band of Wolbachia, or the band of the Insect DNA. After the sequenzing, it was clear, that this is the band of the insect DNA. This Insect isn’t infected with Wolbachia. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
|
| Arthropod COI sequence | Download FASTA
Download AB1
AGATGGATCATTCGAATTGAGCTGGGACAACCAGGAATATTCATTGGAGATGATCAAATTTATAATGTAATTGTTACRGCACATGCATTTATTATAATTTTTTTCATAGTTRTACCRATCATAATTGGAGGATTTGGAAACTGATTAATCCCACTAATAATTGGCGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGATTCTGATTATTACCACCATCATTAACCCTTTTAATAACTAGAAGATTAGTAGAAATAGGTGCAGGAACAGGATGAACTGTATATCCTCCTCTATCAATAGATTATTCCATAGAGGAGCATCAGTAGACTTAGCRATCTTTTCATTACAC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Rhyparochromus pini was found to be negative for Wolbachia. |


CEM-VEN
VRM-MMS Order: Blattodea
(no title)
DEM-KTP Odonata