Rhyparochromus pini RE1

November 8, 2022

Sample information
Picture
Photos by: Robin E.
Location
Collection date 09/14/2022
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

The insect was sitting on a lead of a beech
Putative identification Arthropoda Hexapoda Insecta Hemiptera Rhyparochromidae Rhyparochromus Rhyparochromus pini

Methods
Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain Fast Blast
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

there is one band on he gel. So it could be a sign of Wolbachia. It isn’t clear yet if it is the Band of Wolbachia, or the band of the Insect DNA.

After the sequenzing, it was clear, that this is the band of the insect DNA. This Insect isn’t infected with Wolbachia.
Wolbachia 16S sequence Download FASTA    Download AB1
Arthropod COI sequence Download FASTA    Download AB1
AGATGGATCATTCGAATTGAGCTGGGACAACCAGGAATATTCATTGGAGATGATCAAATTTATAATGTAATTGTTACRGCACATGCATTTATTATAATTTTTTTCATAGTTRTACCRATCATAATTGGAGGATTTGGAAACTGATTAATCCCACTAATAATTGGCGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGATTCTGATTATTACCACCATCATTAACCCTTTTAATAACTAGAAGATTAGTAGAAATAGGTGCAGGAACAGGATGAACTGTATATCCTCCTCTATCAATAGATTATTCCATAGAGGAGCATCAGTAGACTTAGCRATCTTTTCATTACAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Rhyparochromus pini was found to be negative for Wolbachia.
Report Inappropriate Post