Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/05/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | College of Eastern Idaho |
| Observations | Carpenter Ant/found under nesting soil. Found under a rock surrounded by dry dirt and leaves. Many ants were found at the time, and we selected one out of the group. Description: Black head and abdomen with a light-colored yellow orange thorax. Body length: 1.2 cm. Found by Zander Brooks. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Camponotus Camponotus vicinus |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Wolbachia Project PCR Primers for both Wolbachia and CO1 Arthropod. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
TATAAGAATAATTATTCCCTTAGAACTAGGATCCACTAACTCACTAATCATAAATGATCAAACTTTTAATACTATTGTTACAAGACATGCTTTTATCATAATCTTTTTTATAGTTATGCCCTTCATAATTGGGGGATTTGGTAACTTCTTACTCCCCCTAATACTCGGATCTCCTGATATAGCCTATCCCCGTATAAACAACATAAGATTTTGATTACTCCCCCCATCAATCTCCCTCCTAATTCTAAGAAATTTTATTAATGAGGGATCTGGAACAGGTTGAACTATTTATCCCCCCTTAGCGTCTAATACCTTCCATAGGGGTTCATCTATTGATCTAACCATCTTCTCCCTTCNTATTGCTGGTATGTCATCAATTCTTGGAGCANTTAATTTTATTTCAACAATTATAAATATACATAATACTAATATCTCATTAGATAAAATTCCCCTCTTANTTTGATCTATTCTTATCACAGCAATCCTTCTCCTCCTATCCCTCCCCGTCCTTGCCGGANCTATTACNATATTATTAACAGATCGAAATCNTAATACTTCCTTCTTCGATCCATCTGGTGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Camponotus vicinus was found to be negative for Wolbachia. |



North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat