Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/18/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations | Black. Large abdomen with parallel grooves running down the length. Short mandibles. Short orange fur on underside. |
| Putative identification | Arthropoda Insecta |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA EXTRACTION It was a fun time slicing up this bug! MISTAKES We didn’t make any mistakes during the arthropod electrophoresis, but something went wrong for our wolbachia electrophoresis the first time we did it. Luckily, we repeated the experiment and all looks to have gone well. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | DNA extraction Some of the DNA for this sample clogged up the filter, making it hard to wash. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
ACTTGGAACTTCATTAAGACTATTAATTCGGATAGAATTAGGAACCCCTGGTTCATTAATTGGGAACGACCAAATCTATA ACTCTATCGTCACAGCTCATGCTTTTATCATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGA TTAGTTCCTCTAATACTAGGAGCTCCAGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTACTTCCTCCTTC TATTTCATTACTATTAGCTAGAAGATTTATTGAGTCAGGGGCGGGAACAGGATGAACAGTTTACCCTCCTCTTTCCAGTA ATATTGCCCACAGTGGAGCCTCAGTAGATTTAACAATTTTTAGCCTTCATTTGGCAGGAATCTCTTCAATTTTGGGGGCA GTTAATTTTATCTCTTCAATTATAAATATACGAACCCCTGGAATAACAATAGAAAAAATACCTTTATTTGCTTGATCTGT AGGAATTACTGCCGTTCTATTACTTCTTTCTCTCCCAGTATTAGCAGGAGCAATTACAATACTTTTAACCGATCGAAATT TAAATACCTCATTTTTTGACCCAACCGGAnGAGGAGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Insecta was found to be negative for Wolbachia. |





Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis
Aboud kanama