Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/13/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations | I caught the arthropod in my bedroom on the floor. It was caught in the end of summer around 68 Degrees Fahrenheit. It was crawling on the carpet. Everything looked to be normal with the insect and was probably looking for a way to escape. Wings are a golden color, long, and look like narrow ovals. It has a hairy head/thorax, and the color of the insect is yellow and black. It also has long antennas. |
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA Extraction (10/04/23): The liquid was pretty chunky, and the Yellowjacket didn’t crush up easily. The legs ripped off and the body was pretty much just flat at the end. The color of the liquid was a golden color. PCR (October 13, 2023): No mistakes Gel electrophoresis, Arthropod CO1 (October 18, 2023): There was a full band that appeared in this lane. It isn’t as bright as the other bands from other arthropods but it’s pretty bright. No mistakes were made. My DNA extraction worked because it showed up on the gel lab. Gel electrophoresis, Wolbachia Arthropod PCR Day 2 (October 24, 2023): Lane 1: Ladder, Lane 2: Yellowjacket (B1), Lane 3: Spider Cricket (B2), Lane 4: Cicada (B3), Lane 5: Ladybug (B4), Lane 6: Positive Control, Lane 7: Negative Control, Lane 8: Water, Lane 9: Empty
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I’m confident with B1 being negative because no trace of a band showed up on the gel. It seemed that everything worked correctly. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
NNNTNNNNTTTAGGAGCTTCnATAAGAATAATTATTCGCTTAGAATTAAGATCTCCTGGAGCCTTAATTAATAATGATCA AATTTATAATACAATTATTACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTTTTTTAGTAGGAGGATTTG GAAACTGATTAATCCCTTTAATACTAGGTGTACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTACTC CCTCCTTCATTATTTTTACTAATTTTAAGAAATTTTATTGGAACAGGGGTAGGAACAGGATGAACTTTATACCCTCCTTT ATCTTCTATTGTTGGTCATGATTCTCCATCTGTAGATTTAGGAATTTTTTCAATTCATATTGCTGGAATTTCATCAATTA TAGGATCAATTAATTTTATCGTTACTATTTTAAATATACACACAAAAACACATTCATTAAATTTTCTTCCTTTATTCACA TGATCAATTTTAATTACAGCAATTCTTCTTCTATTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTTTTAACAGA TCGGAACTTAAACACATCTTTTTTCGATCCTGCAGGTGGAGGGGACCCAATTTTATATCAACATTTATTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be negative for Wolbachia. |




Blattodea LB2
tenebrio molitor_To1
JC2
YSD2