Sample information |
|
| Picture |
|
|---|---|
| Location | Approximate location: 40.62, -74.57 |
| Collection date | 05/31/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | This arthropod was found walking by the roots of a tree on dry leaves at the edge of the forest at the Pingry Campus in Basking Ridge, New Jersey. The arthropod has the appearance of a wasp, with a stinger, 6 long legs, antennae, a segmented body, and two wings. |
| Putative identification | Arthropoda Insecta Hymenoptera Ichneumonidae |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | The Ophion costatus was found on 5/31/2024 and was placed in ethanol. Prior to extracting the DNA, I ran the arthropod underwater for two minutes and performed DNA precipitation, DNA purification, and DNA elution. After running the DNA through PCR to amplify both its own DNA and the DNA of Wolbachia, I ran gel electrophoresis. In my gel, the Arthropod section is on the top, and the Wolbachia is on the bottom. Each section contains (in order) the DNA ladder, the DNA from the respective arthropods of the three members of my group (mine is lane four), a positive Wolbachia control, a negative Wolbachia control, a DNA+ control, and a water control.
|
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | The band in my gel did not show any Wolbachia DNA, leading me to conclude that my insect does not have a Wolbachia infection. When I ran the BLAST for Ophion costatus, there were no results for Wolbachia and only matches the DNA from Ophion costatus. My confidence level is listed as medium because much of my sequencing was low quality. However, the small sequence that is included in this post had high fidelity and matched most similarly to Ophion costatus, but also matched more distantly to other organisms, ultimately lowering my confidence level to medium. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
|
| Arthropod COI sequence | Download FASTA
Download AB1
TCAGTTTCCGTGCTATGTCCTTCGCTC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Ichneumonidae was found to be negative for Wolbachia. |



Millipede
Brown Widow
(no title)
Texas Carpenter Ant
Boxelder Bug (Hemiptera)