Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 06/03/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | The Agonum punctiforme was discovered next to the pavement by a field of grass. It resembled a beetle at first, being black with a hard shell and two antennas. After sequencing the DNA and running the BLAST search, we can confirm that the insect is an Agonum punctiforme, with 548 base pairs matching that of the Agonum punctiforme. There were only 548 base pairs sequenced, so the match was exact. |
| Putative identification | Arthropoda Insecta Coleoptera Carabidae Agonum Agonum punctiforme |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Extracted the DNA, Purified the DNA, elution of DNA, then did PCR on the DNA separately for the arthropod and Wolbachia, ran a gel on both the arthropod and Wolbachia data, then purified the DNA to send over for sequencing the Wolbachia and arthropod DNA When doing PCR, there may have been a mistake in the PCR cocktail for Wolbachia. More Taq polymerase, water, and primers were added than necessary, so the proportions of the solution may have been inaccurate. There was still cocktail left over after pipetting the solution into each tube for PCR. There may have been contamination in the Wolbachia DNA as well, so the concentration was very low (only 1.4). |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The gel demonstrated a clear absence of Wolbachia, since there was no DNA fragment in the corresponding lane. These results corresponded with the sequencing. In the Wolbachia sequencing, there were no clear base pairs after adding the Wolbachia primers because Wolbachia is not present in the DNA of the Agonum punctiforme. |
| Wolbachia 16S sequence | Download AB1
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
TNNNNNTCGGAGCATGATCNGGAATAGTAGGGACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAATCCTGGAGCATTAATTGGAGATGACCAAATTTATAATGTTATTGTAACTGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCTCCTTCTTTAACACTACTCTTAATGAGAAGTATAGTAGAAAGAGGGGCTGGTACCGGATGAACAGTTTATCCACCTCTATCATCAGGTATCGCCCATGCCGGAGCTTCAGTTGATTTAGCAATTTTTAGTCTTCATTTAGCAGGAGTTTCATCAATTTTAGGGGCTGTAAATTTTATTACAACGATTATTAATATACGATCAGTAGGTATAACATTTGATCGAATGCCATTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTATTGTTACTTTCTTTACCAGTACTAGCAGGAGCCATTACAATATTACTTACAGATCGAAATTTAAATACATCATTTTTCGACCCGGCAGGAGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCTGGAAAGTTTAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Agonum punctiforme was found to be negative for Wolbachia. |



Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft