Goldenrod Soldier Beetle

Sample information

Picture
Photos by: Natasha D
Location
Collection date 09/04/2024
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

Collected by Fall 2024 students

Putative identification Arthropoda Insecta Coleoptera Cantharidae Chauliognathus Chauliognathus pensylvanicus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit.
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

I chose a low confidence level because I had no band for the wolbachia.

Wolbachia 16S sequence Download FASTA    Download AB1
TGCCACACTTGTGTAAAATCCGGCCGAACCGAGTAT
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary The Chauliognathus pensylvanicus was found to be negative for Wolbachia.
Report Inappropriate Post