Harlequin Lady Beetle larvae (?) – Poor DNA Sequence

June 5, 2025

Sample information
Picture
Photos by: Fiona R.
Location
Collection date 06/27/2025
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

A black bug with a reddish orange color on its back. It had 2 black lines going down vertically from its head to the bottom of the insect. It had a spiky head and 6 legs.
Putative identification Arthropoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis

Methods
Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Extracted DNA using the DNeasy extraction kit. Then, created a 2% agarose gel using 1X TAE buffer and agarose. 2 rows of wells were made, the top wells were to test for Arthropod DNA, the bottom wells were to test for Wolbachia DNA. PCR was completed on the samples to get them ready for gel electrophoresis. The first column was for the ladder, the second was my bug sample, the third and fourth were positive and negative arthropod controls, and the last column was a negative DNA control.

Results
Wolbachia presence No
Confidence level Medium
Explanation of confidence level

The insect definitely was an arthropod, because the gel showed the sample to be positive for arthropod DNA in the second column of the top row. However, in the bottom row of wells, there was no Wolbachia present, meaning the insect did have arthropod DNA, but there was no Wolbachia present. Also, the DNA sequencing came back with low quality, and when blasted stated the insect was a Homo sapien. This is where the medium confidence comes from
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GAGATGGTGCTNNAAGGNAACTTGAGTTTANCTGTAATATTTCGCTTGTATTTACAAGANTAATGCNTTCATGTGAATTG AGAAANTACTATGTTGTTATTACAATGGTTTTGTTTTGACTTTTTTTCTAACAAAACTATTTCATTGCATCTTACTAATC ATTTAAAAACCAGAAGAAAATGCATATTTGATTAAAATAGATCTCTTAANTCTAGTTCTCTTTTATGTATCAGGACTTGT GGGTTTTATTTTTANAAGGAAACCTTAATCACTGAAAGCAAAGGTGAAACCATCCTCCACNGAGGCTTNTCAGNAGGTGG GCGGACCATCCTGCAAAACGACCACTCACTACTGGCCAGCANCTGGGCTTCTGCNGAACTTCATGCCCCACCAGGTAAAG CAGGCCTCCNAAAGTCCAGTTTGNATGTTTTGGACTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Harmonia axyridis was found to be negative for Wolbachia.
Report Inappropriate Post