Schistocerca americana

Sample information

Picture
Photos by: Ibrahim M.
Location
Collection date 09/02/2025
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

Collected by fall 2025 students with a killing jar nearby trees and tall grass.

Putative identification Arthropoda Insecta Orthoptera Acrididae Melanoplus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit.
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

DNA was isolated out of the insect abdomen with the use of the DNeasy (Qiagen) Blood and Tissue Kit in accordance with the standard protocol. Tissue was lysed in Buffer ATL containing Proteinase K and incubated until digested, then attached to a silica column, rinsed with Buffers AW1 and AW2 and washed off into AE buffer.

A single reaction of PCR amplification was done and the 16S and COI amplifications were run separately under thermal cycling. PCR products were separated on an agarose gel by the use of a standard electrophoresis system utilizing the TAE buffer. The DNA stain was SYBR Safe. Samples were loaded and a molecular weight was used to confirm anticipated band sizes. Electrophoresis was performed, followed by visualization of gels in the blue light transilluminator, and imaging was done.

The presence or absence of the band was taken to assess the presence of Wolbachia in the insect and the samples with clear and distinct bands were sequenced. Where feasible, sequence quality and results of BLAST were done to establish the level of confidence in the identification of Wolbachia.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

Had a thick COI gel band, but no Wolbachia gel band. This was also compared to the controls of W- and W+ as W- showed a band for COI, but not for Wolbachia and W+ showed a COI band and a Wolbachia band. The blast had a 100 percent identity for Melanoplus species and an e-value of 0.0 confirming my results.

Wolbachia 16S sequence Download FASTA    Download AB1
>60-DW_B4_WoR.scf (311 bp) TCGAGTTGCAGAGTACAATCCGAACTGAGATGTCTTTTAGGGATTAGCTTAGGCTTGCGCACCTTGCAACCCATTGTAGA CACCATTGTAGCACGTGTGTAGCCCACTNNATAAAGGCCATGATGACTTGACATCATCCCCACCTTCCTCCAGCTTATCA CTGGCAGTTTCCTTAAAGTACTCAGCATTACCTGATAGCAACTAAGGATGAGGGTTGCNNTCGTTGCGGGACTTAACCCA ACATCTCACGACACGAGCTGACGACAGCCATGCAACACTTGNGNNAAATCCGGCCGAACCGACCCTATCCC
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
>11-DA_V2_CoR.scf (571 bp) GTATTTAAATTTCGATCAGTTAATAATATTGTAATAGCTCCTGCTAATACAGGAAGTGATAATAATAAAAGGAGTGCTGT AATAGCTACTGATCAAACAAATAATGGTGTTTGGTCTAGTGTTATTCTTTCTGATCGTATATTAATTGCTGTTGTAATAA AATTGACTGCCCCTAGAATTGATGAAACACCAGCTAAGTGAAGAGAGAAAATGGCTAAATCAACTGACGCTCCACCATGT GCAATTGCTCCAGCGAGTGGGGGGTAAACTGTTCATCCTGTACCAGCTCCATTATCAACCATAGATGAGGTAAGTAAAAG GGTTAGTGATGGTGGTAAAAGTCAAAAACTTATATTATTTATTCGTGGAAAAGCTATATCTGGTGCTCCAATTATTAATG GTACAAGTCAATTACCAAATCCTCCAATTATAATAGGTATTACTATAAAGAAAATTATTACAAATGCGTGGGCTGTAATA ATTACATTATAGATTTGGTCATCTCCAATTAGAGATCCTGGTTGTCCTAGTTCTGCTCGAATAATTATTCTTATAGAAGT TCCTACTATTC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Melanoplus was found to be negative for Wolbachia.
Report Inappropriate Post