Boxelder Bug 3

Sample information

Picture
Photos by: Ayush P.
Location
Collection date 11/13/2025
Captive / Cultivated? Wild-caught
Group NCSSM
Observations
After my teacher mentioned that her husband had been seeing unfamiliar insects in the window of his office, I checked the area and quickly noticed several boxelder bugs clustered near the frame. The temperature was around 55°F, which likely encouraged them to seek warmth indoors. I collected some of the bugs for closer observation.
Putative identification Arthropoda Insecta Hemiptera Rhopalidae Boisea Boisea rubrolineata

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain
Gel images
Protocol notes

DNA Extraction: Because our boxelder bugs were smaller than a grain of rice, we did not dissect them. Instead, we used a standard whole-body tissue extraction method by placing a small portion of the bug into the extraction buffer and mechanically breaking down the tissue to release genomic DNA.

Gel Electrophoresis: We amplified the extracted DNA using both arthropod and Wolbachia primers. The arthropod primer served as a positive control to confirm that the PCR reaction worked and that our DNA extraction was successful. The Wolbachia-specific primer allowed us to test for the presence of Wolbachia DNA within the boxelder bug samples. After PCR, we ran the products through gel electrophoresis to visualize amplification results and determine whether Wolbachia was present.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

The clear arthropod band indicates that our DNA extraction and PCR worked properly, which supports the reliability of the procedure. However, since there was no Wolbachia band and we lacked a confirmed Wolbachia-positive control to verify that the primers were functioning, we cannot be completely certain that the absence of amplification represents a true negative.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
GATCTGGTATAGTAGGTTCATCTTTAAGATGAATTATTCGTGTAGAATTAGGACAACCTGGTAGATTTAT TGGAGATGATCAAACATATAATGTAATTGTAACAGCACATGCTTTTATTATAATTTTCTTTATAGTTATG CCAATTATGATTGGTGGATTTGGGAATTGATTAGTGCCTTTAATAATTGGGGCCCCAGATATAGCATTTC CTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCCCTTACTTTATTACTTGCAAGTAGTATAGT TGAAAGAGGGGCGGGAACTGGATGAACAGTTTACCCTCCTCTATCAAGAAATTTATCCCATAGAGGTGCC TCTGTAGATTTAGCAATTTTTTCATTACACTTAGCAGGTGTATCATCAATTTTAGGGGCTATTAATTTTA TTTCAACTATTATTAATATACGGCCAGCAGGAATAAGACCTGAACGAATACCATTATTTGTATGATCAGT AGGTATTACAGCCCTTCTGTTATTGTTGTCTTTACCTGTTTTAGCGGGGGCCATTACAATACTTTTAACT GACCGAAACTTTAATACATCTTTCTTTGATCCTACCGGAGGAG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Boisea rubrolineata was found to be negative for Wolbachia.
Report Inappropriate Post