Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | This arthropod specimen is a black fungus gnat that belongs to the genus Pseudolycoriella Sp. It was collected outdoors at Benedictine University and is a small, dark colored fly commonly found in moist environments. The fungus gnat has thin long legs, one pair of wings, and a slender body, which are all characteristic features of dipteras. |
| Putative identification | Arthropoda |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I am highly confident in these results since both the positive and negative controls worked the way they were supposed to. The positive control showed a clear Wolbachia band at the expected size, which confirms that the PCR worked correctly. The negative control showed no bands, showing that no contamination was present. My arthropod sample showed a strong COI band, proving that the DNA extraction and insect DNA amplification were successful, but no Wolbachia band was present. These results support the conclusion that my fungus gnat specimen was not infected with Wolbachia. |
| Wolbachia 16S sequence | Download FASTA
>60-DW_B4_WoR.ab1 (305 bp) TGCAGAGTACAATCCGAACTGAGATGTCTTTTAGGGATTAGCTTAGGCTTGCGCACCTTGCAACCCATTGTAGACACCAT TGTAGCACGTGTGTAGCCCACTCCATAAAGGCCATGATGACTTGACATCATCCCCACCTTCCTCCAGCTTATCACTGGCA GTTTCCTTAAAGTACTCAGCATTACCTGATAGCAACTAAGGATGAGGGTTGCACTCGTTGCGGGACTTAACCCAACATCT CACGACACGAGCTGACGACAGCCATGCAACACTTGTGTGAAATCCGGCCGAACCGACCCTATCCC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
>13-DA_G1_CoR.ab1 (524 bp) CAGTAATAAATACGGATCACACAAATAAAGGTATTTTATCAAATGTTATTCCTGGGGCTCGTATATTAATAATTGTTGAA ATAAAATTTACAGCCCCTAAAATTGATGAAATACCTGCAAGATGTAAGGAAAAGATTGAAAGATCTACAGAGGCCCCCGT ATGTGCAATAGTTGAAGACAAAGGAGGATAAACTGTTCAACCTGTTCCAGTTCCTCTATCTACCAAACTACTTGTTAATA AAAGAGTTAATGATGGAGGTAATAACCAAAATCTTATATTATTTAATCGGGGAAATGCTATGTCAGGGGCGGATAATATT AATGGAACTAATCAATTTCCAAATCCTCCAATTATAATTGGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCAGT TACAATTACATTATAAATTTGATCATCTCCAATTAAAGCAAATGGATAACCTAATTCTGCTCGAATTAATATACTTAATG ATGTTCCTACTATTCTAGACCACGCCCCAAAAATAAAATATAAT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Arthropoda was found to be negative for Wolbachia. |


Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis
Aboud kanama