Cerodontha dorsalis

Sample information

Picture
Entry by: Joudy . M
Location
Approximate location: 41.78, -88.10
Collection date 09/10/2025
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

The collected specimen was a small insect, confirmed via DNA barcoding (COI gene sequencing) and BLAST analysis to be Cerodontha dorsalis (the Leaf-miner Fly). The identification showed a perfect 100.00% percent identity match.

This species belongs to the Order Diptera (True Flies) and is ecologically significant as an agricultural pest due to the larvae’s leaf-mining activity.

Testing for the endosymbiont bacterium Wolbachia using PCR and Gel Electrophoresis revealed no 438 bp band , concluding that this individual is Wolbachia-negative.

Putative identification Arthropoda

Methods

Extraction kit DNeasy (Qiagen) blood + tissue kit with modification P2 for ATL + N3 for AL
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain Ethidium Bromide
Gel images
Protocol notes

The DNA was successfully extracted from the Whole arthropod specimen (identified as Cerodontha dorsalis ) using a Qiagen DNeasy Blood and Tissue Kit with modifications.

PCR was performed as a Duplex Reaction to simultaneously amplify the COI gene (~700 bp) for species identification, and the Wolbachia gene (~438 bp)  for infection status.

The products were visualized via Gel Electrophoresis using a 1% Agarose Gel and 1X TAE buffer. Results confirmed the successful amplification of the COI gene (clear ~700 bp band) but showed no 438 bp band , indicating the specimen is Wolbachia-negative

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

High Confidence. We can trust these results because several controls functioned properly.

1. Successful DNA Extraction & PCR: The COI gene was successfully amplified (clear band at ~700 bp) for the specimen. The COI gene serves as an internal positive control, confirming that the DNA extraction worked and the PCR mixture was functional.

2. High-Quality Sequencing: The sequencing process yielded high-quality base calls (Phred scores) , resulting in a 100.00% percent identity match via BLAST for the species ID.

3. Clear Negative Result: The expected band for Wolbachia infection was clearly absent 6, allowing for a definitive conclusion: the specimen is Wolbachia-negative

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA   
ATGTGCAATAATAGATGATAAAGGTGGATAAACTGTTCATCCTGTACCAGCTCCATTTTCAACTATTCTACTTATAAGCAATAATGTTAATGAAGGAGGTAAAAGTCAAAAACTTATATTATTCATTCGAGGAAAAGCTATATCTGGTGCACCTAATATTAAAGGTACTAGTCAGTTACCAAAGCCACCAATTATAATAGGTATAACTATGAAAAAAATTATAATAAAAGCATGAGCAGTAACAATTACATTATAAATTTGATCATCACCAATTAAGGCTCCTGGATGTCCTAAT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Arthropoda was found to be negative for Wolbachia.
Report Inappropriate Post