Sample information |
|
| Picture |
|
|---|---|
| Location | Approximate location: 41.78, -88.10 |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2025 students. |
| Putative identification | Arthropoda Insecta Dermaptera Forficulidae Forficula Forficula auricularia |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We completed the whole DNA extraction, PCR, gel electrophoresis protocol steps. Gel electrophoresis however was not optimal since we did not have optimal movement from the ladder and control wells, and the most bands were stuck in the wells or did not appear clear enough, indicating that there might have been an error in the gel making or in the process of loading or running the gel. Amplification using PCR was sufficient to run sequencing, identifying arthropod and finding Wolbachia. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | Although gel electrophoresis showed faint or unclear bands, successful Sanger sequencing and BLAST analysis confirmed both the arthropod identity and the presence of Wolbachia. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
AAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACAC GTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGT ACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCT TGTACACACTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
AGATAGAGGAGCTGGTACAGGTTGGACAGTTTACCCCCCTTTGTCGGGGGCCATCGCCCACGCAGGGGCTTCGGTAGATT TGAGTATTTTTTCATTGCATTTGGCAGGGATTTCATCAATTTTGGGGGCAATTAATTTTATCACAACGGTGATTAATATG CGCCCATCG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Forficula auricularia was found to be postive for Wolbachia. |




Millipede
Brown Widow
(no title)
Texas Carpenter Ant
Boxelder Bug (Hemiptera)