Nylanderia (Crazy ant, Wolbachia -)

Sample information

Picture
Entry by: Bora A
Location
Approximate location: 40.62, -74.57
Collection date 05/26/2026
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

Brown-black, 6 legs, winged, ant-shaped, has antennae, about the size of a grain of rice. Found right outside the woods behind The Pingry School, Basking Ridge, NJ, outside the walking path.

Putative identification Arthropoda

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system 1X Agarose Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR-SAFE
Gel images
Protocol notes

First, DNA extraction was conducted with a DNEasy Qiagen Kit. Then, PCR was done for COI and for Wolbachia with COI and Wolbachia primers. Then, 1% gel with a 100bp ladder was run, and the PCR was purified with a QIAquick kit and then sequenced.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

The gel results indicate that Wolbachia is not present in the ant, as lane 3 in the Wolbachia gel shows no bands. Confidence level is high, as all controls worked, and arthropod DNA was present in the bug in lane 3 of the arthropod gel.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
TGGGTCCTCTATAAGTATAATTATTCGTTTAGAATTAGGATCTCCAAATGCTTTAATTAATAATGATCAAATTTATAATTCCATAGTTACTAGACATGCTTTCATTATAATTTTCTTCATAGTAATGCCTTTTATAATTGGTGGATTCGGGAATTTTTTAGTTCCATTAATACTTGGGTCCCCTGATATAGCTTATCCCCGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCCTTATCATTACTTTTATTAAGAAATTTTATTAATGATGGAGTCGGAACAGGTTGAACAGTTTATCCCCCTTTAGCATCTAATATTTTTCATAATGGCCCCTCAGTTGATCTTGCTATTTTTTCTTTACATATTGCTGGGATATCCTCAATTCTAGGGGCTATTAATTTTATTTCTACTATTCTAAATATACATCATAAAAATTTTTCAATTGATAAAATTCCCCTTCTTGTTTGATCTATCCTAATTACAGCAATTCTTCTTCTTTTATCATTACCAGTACTAGCTGGAGCAATCACTATGTTATTGACAGATCGTAATTTAAATACCTCTTTTTTCGATCCCTCTGGGGGGGGTGATCCAATCCTTTACCAACACTTATTCTGATTTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Arthropoda was found to be negative for Wolbachia.
Report Inappropriate Post