Myrmica rubra RE2

Sample information

Picture
Entry by: Robin E.
Location
Approximate location: 47.40, 9.62
Collection date 09/14/2022
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

The ant was walking on the ground beween the grass

Putative identification Arthropoda Insecta Hymenoptera Formicidae Myrmica Myrmica rubra

Methods

Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain Fast Blast
Gel images
Protocol notes

I can’t see any bands on the gel. Others (my teachers) said they could see bands. According to my eyes, there were no bands.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

There was no clear border to be seen, only a very weak one, so there is a low-medium possibility of Wolbachia.

After the sequencing it was clear, that the Insect wasn’t infected with Wolbachia. The one weak band which my teachers saw was in that case the band of the Insect DNA.

Wolbachia 16S sequence Download FASTA    Download AB1
Arthropod COI sequence Download FASTA    Download AB1
ATTCTCTTGTAACYAGCCATGCCTTTATTATAATTTTTTTTATAGKTATACCATTTATAATTGGGGGCTTTGGWAATTTTTTAATTCCTTTAATATTAGGATCACCTGATATAGCATACCCACGAATAAATAACATAAGATTTTGATTACTTCCCCCTTCWATTATACTATTAATATTAAGAAATTTTTTAAGGAATGGKGTAGGTACAGGATGAACCATTTACCCCCCTCTAGCTTCTAATATTTTCCATAGAGGACCTTCAATTGATATATCAATCTTTTCTCTTCATATCGCTGGAATATCATCTATTTTAGGTGCTATTAATTTTATCTCAACAATTATTAATATACATCATAAATCAGTATCAATAGACAAAATCCCCTTAATAGTCTGATCAATTTTAATCACAGCTATTCTTCTCTTACTTTCCTTACCAGTCTTAGCAGGAGCAATTACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTCGACCCATCTGGGGGGGGAGATCCAATTTTATACCAACATCTATTTTGATTTTTTGG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Myrmica rubra was found to be negative for Wolbachia.
Report Inappropriate Post