Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/14/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | The ant was walking on the ground beween the grass |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Myrmica Myrmica rubra |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | Fast Blast |
| Gel images |
|
| Protocol notes | I can’t see any bands on the gel. Others (my teachers) said they could see bands. According to my eyes, there were no bands. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | There was no clear border to be seen, only a very weak one, so there is a low-medium possibility of Wolbachia. After the sequencing it was clear, that the Insect wasn’t infected with Wolbachia. The one weak band which my teachers saw was in that case the band of the Insect DNA. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
|
| Arthropod COI sequence | Download FASTA
Download AB1
ATTCTCTTGTAACYAGCCATGCCTTTATTATAATTTTTTTTATAGKTATACCATTTATAATTGGGGGCTTTGGWAATTTTTTAATTCCTTTAATATTAGGATCACCTGATATAGCATACCCACGAATAAATAACATAAGATTTTGATTACTTCCCCCTTCWATTATACTATTAATATTAAGAAATTTTTTAAGGAATGGKGTAGGTACAGGATGAACCATTTACCCCCCTCTAGCTTCTAATATTTTCCATAGAGGACCTTCAATTGATATATCAATCTTTTCTCTTCATATCGCTGGAATATCATCTATTTTAGGTGCTATTAATTTTATCTCAACAATTATTAATATACATCATAAATCAGTATCAATAGACAAAATCCCCTTAATAGTCTGATCAATTTTAATCACAGCTATTCTTCTCTTACTTTCCTTACCAGTCTTAGCAGGAGCAATTACTATATTATTAACAGATCGTAATTTAAATACTTCTTTTTTCGACCCATCTGGGGGGGGAGATCCAATTTTATACCAACATCTATTTTGATTTTTTGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Myrmica rubra was found to be negative for Wolbachia. |


Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft