Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/28/2020 |
| Captive / Cultivated? | Wild-caught |
| Group | Unterstrass |
| Observations | |
| Putative identification | Arthropoda Insecta Diptera Phoridae |
Methods |
|
| Extraction kit | Wizard SV (Promega) |
| DNA extraction location | |
| Single or Duplex PCR | |
| Gel electrophoresis system | |
| Buffer | |
| DNA stain | |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | |
| Explanation of confidence level | |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GAGTCNTGATGGTGGGCACATCTTAAGAGTATGTAATTCGTGCTGAATTAGGGCGCCCCGGGCTTTATTTGGAGATGATCAAATTGATAATGTAATTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Phoridae was found to be negative for Wolbachia. |
Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis