Mycetophila fungorum GC2

May 2, 2024

Sample information
Picture
Photos by: Gianin C.
Location
Collection date 03/07/2024
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

Flown around in the forest and landed on the ground, where the insect was then caught.
Putative identification Arthropoda Hexapoda Insecta Diptera Mycetophilidae Mycetophila Mycetophila fungorum

Methods
Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

Since the cytochrome oxidase band is recognizable, the results are reliable.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
CTTAAGAGTTATTATTCGAACTGAACTTGGTCACCCAGGAGCTTTAATTGGAAATGACCAAATTTATAATGTAGTTGTTACTGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCACTAATATTAGGAGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTACTTTCAAGTAGCTTAGTTGAAGCAGGGGCTGGAACAGGATGGACAGTGTACCCCCCACTTTCATCTACTATTGCTCACG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Mycetophila fungorum was found to be negative for Wolbachia.
Report Inappropriate Post