Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/07/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | Flown around in the forest and landed on the ground, where the insect was then caught. |
| Putative identification | Arthropoda Insecta Diptera Mycetophilidae Mycetophila Mycetophila fungorum |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Since the cytochrome oxidase band is recognizable, the results are reliable. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CTTAAGAGTTATTATTCGAACTGAACTTGGTCACCCAGGAGCTTTAATTGGAAATGACCAAATTTATAATGTAGTTGTTACTGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCACTAATATTAGGAGCCCCCGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTACTTTCAAGTAGCTTAGTTGAAGCAGGGGCTGGAACAGGATGGACAGTGTACCCCCCACTTTCATCTACTATTGCTCACG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Mycetophila fungorum was found to be negative for Wolbachia. |


Umbrella Wasp
Fannia Canicularis
Oulema Obsucra JM2
Collembola
Linyphiidae BK1