Sample information |
|
Picture |
![]() ![]() |
---|---|
Location | |
Collection date | 03/14/2024 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | Found in the forest, alone under a dead treetrunk. |
Putative identification | Arthropoda Myriapoda Diplopoda Julida Julidae Tachypodoiulus Tachypodoiulus niger |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Rear half |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
![]() |
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | I am confident, because the cytochrome oxidase band (around 700) is seen, but no Wolbachia. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
CTAACTGGAWGGTGCCGATGATGATAGGTGCGCCAGACATGGSGTTCCCTAGGCTGAACAACATGAGCTTTTGGTTGTTAATTCCTGCGGCTATCTTACTAGTGGTTTCTATTTTTGTACCAGGTGGGGCGATAGCRGGGGCTGGACAATGTATCCACCACTGTCTCTACAACAAG
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Tachypodoiulus niger was found to be negative for Wolbachia. |