Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/14/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | Found in the forest, alone under a dead treetrunk. |
| Putative identification | Arthropoda Diplopoda Julida Julidae Tachypodoiulus Tachypodoiulus niger |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Rear half |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I am confident, because the cytochrome oxidase band (around 700) is seen, but no Wolbachia. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CTAACTGGAWGGTGCCGATGATGATAGGTGCGCCAGACATGGSGTTCCCTAGGCTGAACAACATGAGCTTTTGGTTGTTAATTCCTGCGGCTATCTTACTAGTGGTTTCTATTTTTGTACCAGGTGGGGCGATAGCRGGGGCTGGACAATGTATCCACCACTGTCTCTACAACAAG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Tachypodoiulus niger was found to be negative for Wolbachia. |



Centipede – MJAR
Fruitfly – MJAR
Ant – MJAR
Mosquito – MJAR
Bumblebee – MJAR