B-5-Gryllus pennsylvanicus

Sample information

Picture
Entry by: Max
Location
Collection date 09/23/2024
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

The Arthrpod was caught in a house’s basement. It is very large and features long, spindly legs. It looks kind of like a grasshopper. It was very large. It seemed to do very well with dark spaces in an urban house’s basement. It was fall, and the house was 75 degrees Fahrenheit.

Putative identification Arthropoda Insecta Orthoptera

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction

  1. The DNA extraction went well for the most part. The only issues of note are that we added about 50ul of extra Buffer to B-2, B-3, and B-5. We also spilled a little bit of B-5.

PCR”:

  1. There was one notable mistake during the PCR, we forgot to switch pipette tips between samples possibly contaminating them.

Gel electrophoresis, Arthropod CO1

  1. The ladder was marked on all Gels
  2. Samples B-1 through B-6 were positive for arthropod DNA
  3. The positive and negative controls were also marked positive and water was marked negative

Gel electrophoresis, Wolbachia

  1. B-1 through B-5 were negative and B-6 was positive
  2. The controls worked with both negative and water controls marked negative and the positive control marked positive
  3. There were no notable mistakes or errors

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

The gel came back very clear. There is no indication of Wolbachia. The positive control came back positive, while the negative control was negative. This indicates that everything went smoothly. There were some issues with contamination in B-2, B-3, B-4, B-5, and B-6, as the pipette tips were not properly changed. The gel ran flawlessly, so any contamination was minute.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
NNnTCATTAAGTATCTTAATCCGAACAGAACTAGGCCAACCAGGCTATTTAATTGGGGATGATCAAACTTATAACGTTAT TGTAACCGCACATGCATTTATCATGATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTTC CATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTCTACCCCCGTCATTAACC CTTTTATTAACCAGAAGAATAGTCGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCACCTTTATCAACAGGAATTGC TCATGCAGGAGCATCTGTTGATTTAGCTATTTTCTCGCTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTGTAAATT TTATTACTACCATAATTAATATACGAGCACCAGGAATATCATTAGATCAAACGCCATTATTTGTTTGAGCAGTTGGAATT ACAGCTCTTCTATTATTATTATCACTACn
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Orthoptera was found to be negative for Wolbachia.
Report Inappropriate Post