Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/23/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations | The Arthrpod was caught in a house’s basement. It is very large and features long, spindly legs. It looks kind of like a grasshopper. It was very large. It seemed to do very well with dark spaces in an urban house’s basement. It was fall, and the house was 75 degrees Fahrenheit. |
| Putative identification | Arthropoda Insecta Orthoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA Extraction
PCR”:
Gel electrophoresis, Arthropod CO1
Gel electrophoresis, Wolbachia
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The gel came back very clear. There is no indication of Wolbachia. The positive control came back positive, while the negative control was negative. This indicates that everything went smoothly. There were some issues with contamination in B-2, B-3, B-4, B-5, and B-6, as the pipette tips were not properly changed. The gel ran flawlessly, so any contamination was minute. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
NNnTCATTAAGTATCTTAATCCGAACAGAACTAGGCCAACCAGGCTATTTAATTGGGGATGATCAAACTTATAACGTTAT TGTAACCGCACATGCATTTATCATGATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTTC CATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTCTACCCCCGTCATTAACC CTTTTATTAACCAGAAGAATAGTCGAAAATGGTGCAGGAACAGGATGAACAGTTTATCCACCTTTATCAACAGGAATTGC TCATGCAGGAGCATCTGTTGATTTAGCTATTTTCTCGCTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTGTAAATT TTATTACTACCATAATTAATATACGAGCACCAGGAATATCATTAGATCAAACGCCATTATTTGTTTGAGCAGTTGGAATT ACAGCTCTTCTATTATTATTATCACTACn
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Orthoptera was found to be negative for Wolbachia. |




Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis