Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/12/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Walton High School |
| Observations | Environment was a forested area. Found near medium-sized rocks and on moist area under leaves and branches. No other ants were apparent or seen near the ant. |
| Putative identification | Arthropoda |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | Gel results for determining presence of Wolbachia in this specimen were not conclusive. Unclear bands may have been due to error during PCR, specifically with the centrifuging timeline during the process. Clear bands were present for the CO1 gel, and results were sent for specimen identification. |
Results |
|
| Wolbachia presence | Unknown |
| Confidence level | High |
| Explanation of confidence level | Wolbachia gel electrophoresis results were not clear, with bands being blurry and indistinct. The PCR Positive control was faint while the positive Drosophila control was nonexistent. Unclear results from the controls, likely due to poor DNA extraction, prevent accurate Wolbachia determination. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
TTGTTTTTTCGTTGCATTTGATCANGAATAATTGGTTCTTCAATAAGAATAATTATTCGATTAGAATTAGGATCCCCTGATTCACTAATTCTTAATGATCAAACCTTTAATACTATTGTTACAAGCCATGCTTTTATTATAATCTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGTAACTTCTTAGTACCCTTAATACTTGGATCTCCCGATATAGCCTACCCACGCATAAATAACATAAGATTTTGATTGCTACCCCCTTCAATCTCTCTATTAATCTTAAGAAACTTTATTAATGAAGGATCAGGTACAGGTTGAACTATTTACCCCCCTCTATCGTCTAATACCTTTCATAGTGGTCCCTCTATTGATTTAACTATTTTTTCCCTTCATATTGCCGGAATATCATCAATTCTAGGAGCAATCAATTTTATTTCAACAATTTTAAATATACATAATTCTAATATTTCTTTAGATAAAATTCCTCTATTAGTATGATCTATTCTTATCACTGCTATTCTCCTTCTCCTCTCCCTTCCTGTTCTTGCAGGAGCTATTACAATACTACTTACAGACCGAAATCTCAATACTTCATTCTTTGATCCCTCGGGAGGAGGAGACCCTATTCTATACCAACACTTATTTTGATTTTTTGGTCACCTTGAAAGTTAAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | |



Japanese Burrowing Cricket, State College, PA – Wolbachia Results
Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)