Dusty Stink Bug (Euschistus tristigmus)

Sample information

Picture
Entry by: Shawn O
Location
Approximate location: 40.56, -75.40
Collection date 09/11/2025
Captive / Cultivated? Wild-caught
Group Penn State Lehigh Valley
Observations

Putative identification Arthropoda Insecta Hemiptera Pentatomidae Euschistus Euschistus tristigmus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Green
Gel images
Protocol notes

Procedure for Casting Gels and Loading Samples

Gel results are read from lane 1 (bottom-most lane) to lane 8 (top most lane). The results pertinent to this entry (Stinkbug) are in LANE 3.

Lane 1: DNA Ladder

Lane 2: Arthropod 1 (Wol + COI1)

Lane 3: Arthropod 2 (Wol + COI1, Stinkbug Pertinent to THIS entry)

Lane 4: Wol Pos Wol + COI1

Lane 5: Wol Neg Wol + COI1

Lane 6: gDNA control Wol + COI1

Lane 7: water control Wol + COI1

Lane 8: EMPTY

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

The confidence level is high as the controls resulted in expected outcomes. Both Wolbachia controls (Lanes 4 and 5) have the Wolbachia band present and not present, respectively. Additionally, the DNA control bands (Lanes 6 and 7) are present and missing, respectively. Finally, the third control (Lane 8) has no band present at all. Taken all together, this confirms that no cross contamination likely occurred, technique of extraction, PCR, and gel electrophoresis was performed adequately. Therefore, the results for the entry-documented arthropod (Lane 3) are assumed to be accurate.

Wolbachia 16S sequence
Arthropod COI sequence
GAGCAGGATAGTGGGGTCCGCTATAAGAATTATTATTCGTATTGAATTAGGACAACCAGGA AGATTTATTGGAGATGATCAAATCTATAATGTTGTAGTTACTGCTCACGCATTCGTTATAATTTTTTTTATAGTAATACC AATTATAATTGGAGGATTTGGTAACTGACTAGTGCCATTAATAATTGGAGCTCCTGATATAGCATTCCCTCGAATAAATA ATATAAGATTCTGATTATTACCCCCTTCAATTACTTTATTAATAATAAGTAGATTAGCTGAATCAGGGGCTGGAACCGGC TGAACTGTATACCCCCCACTATCAAGTAATCTATCCCACAGAGGAGCATCAGTAGACTTGGCTATCTTTTCCTTACACTT AGCAGGTGTTTCTTCAATTCTAGGAGCTGTAAATTTCATTTCAACAATTATAAATATACGACCCGAAGGAATAATCCCAG AACGAATCCCCTTATTCGTATGATCAGTAGGAATTACAGCACTATTATTACTACTTTCCCTTCCCGTATTAGCAGGAGCT ATTACTATATTATTAACCGATCGCAACTTTAATACATCCTTCTTTGATCCTTCAGGAGGAGGGGATCCTATCTTGTATCA ACATCTATTCTGATTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Euschistus tristigmus was found to be negative for Wolbachia.
Report Inappropriate Post