Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/15/2031 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | collected by Fall 2024 students |
| Putative identification | Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit. |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | •Arthropod DNA: (708 bp)
Yes present •Wolbachia DNA: (438 bp)
Not present The presence of the band at 708 base pair confirms that arthropod DNA was present and our DNA extraction and PCR worked. No band was present for Wolbachia DNA which shows that Wolbachia DNA was not present in my sample. |
Results |
|
| Wolbachia presence | Unknown |
| Confidence level | Low |
| Explanation of confidence level | DNA extraction and PCR were successful and not a failure because obtained 46.4 ng/microliter of DNA. My pill bug came from a population with low Wolbachia infection. |
| Wolbachia 16S sequence | Download FASTA
|
| Arthropod COI sequence | Download FASTA
>56_A_AR4_CoAf.ab1 (75 bp) GATGGTAGATGATAGACGTGCGTTATGCGCTTTGAGAGACCAAACTGTAAGAGATTGTTGGGGAAACATTGTTAG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | |
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat