Armadillidium vulgare

Sample information

Picture
Entry by: Safeena T
Location
Collection date 11/15/2031
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

collected by Fall 2024 students

Putative identification Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit.
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes
•Arthropod DNA: (708 bp)

Yes present

•Wolbachia DNA: (438 bp)

Not present

The presence of the band at 708 base pair confirms that arthropod DNA was present and our DNA extraction and PCR worked.

No band was present for Wolbachia DNA which shows that Wolbachia DNA was not present in my sample.

Results

Wolbachia presence Unknown
Confidence level Low
Explanation of confidence level

DNA extraction and PCR were successful and not a failure because obtained 46.4 ng/microliter of DNA.

My pill bug came from a population with low Wolbachia infection.

Wolbachia 16S sequence Download FASTA   
Arthropod COI sequence Download FASTA   
>56_A_AR4_CoAf.ab1 (75 bp) GATGGTAGATGATAGACGTGCGTTATGCGCTTTGAGAGACCAAACTGTAAGAGATTGTTGGGGAAACATTGTTAG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary
Report Inappropriate Post