Clay-colored Agonopterix Moth GRP 12

Sample information

Picture
Entry by: Sarahbelle A.
Location
Collection date 04/21/2026
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

The insect was found alone resting on a small plant in a large piece of vacant land next to parking lot, the area had little patches of grass growth and other small plants with a few trees spread out, it was mostly made up of dirt and gravel with a few small hills. The insects’ body was flat, and it had clayed colored wings with black and brown spots making it seem like it’s the species known as the clay-colored Agonopterix.

Putative identification Arthropoda

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain UView
Gel images
Protocol notes

The gel was a 1%

It was run at a voltage of 165 volts and then it slowly decreased to 95 volts throughout the hour, and a half the gel was run for.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

The control for the experiment worked, this is known to be true because after conducting the gel electrophoresis, the Wolbachia Positive control had 2 visible bands while the Wolbachia Negative had 1 visible band. This demonstrated that the Wolbachia Positive control was an arthropod with Wolbachia. In addition, the estimated base pair values (bp) of 421.697 and 635.331 calculated for the Wolbachia Positive control bands closely aligned with the known base pair values of Wolbachia which is 438 bp and 708 bp for Arthropod. Lastly, after receiving our results from the Wolbachia Database Lab, it can be seen that the Moth had a DNA sequence in the 600 bp range (648 bp specifically) and it was longer than the Wolbachia Positive DNA sequence for an arthropod that is in the 400 bp range (specifically 449 bp). Therefore, the moth tested was not positive for Wolbachia.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AGCAGGTATAGTAGGAACATCTTNAAGTTTATTAATTCGAGCTGAATTAGGANNNNNNNNNCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAANNGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGCTTTGGAAACTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTTTACCTCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTATATCCACCTTTATCTTCTAATATTGCCCATGGAGGAAGATCAGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAGTTAATGGAATATCATTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATCACAGCTTTATTACTTTTATTATCTCTTCCTGTATTGGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTCTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACCCTGGAAGTTTAAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Arthropoda was found to be negative for Wolbachia.
Report Inappropriate Post