GRP6 Common Pill Bug (A. vulgare) – CSUDH #3

Sample information

Picture
Entry by: Suzanne C.
Location
Collection date 04/24/2026
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

This pill bug was found near shrubs in the CSUDH reserve. It was collected in the morning (approximately 9 AM). There were many of its kind in the surrounding area.

Putative identification Arthropoda Malacostraca Isopoda

Methods

Extraction kit Edwards Buffer
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TAE
DNA stain 100X Fast Blast
Gel images
Protocol notes

*NOTE: Lanes are numbered when the gel image is clicked.

DNA Stain

We used an overnight stain and let it stain for approximately 24 hours.

Gel Electrophoresis

10 microliters of sample were added per well for this 1% agarose gel.

This is the lane order for the gel:

1. DNA Ladder

2. High Altitude Roly-Poly #1 (Palos Verdes)

3. High Altitude Roly-Poly #2 (Palos Verdes)

4. Low Altitude Roly-Poly #3 (CSUDH) – this isopod.

5. Low Altitude Roly-Poly #4 (CSUDH)

6. Positive Arthropod CO1F Gene Control

7. Negative Arthropod CO1F Gene Control

8. Positive DNA Control

9. Water

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

We present high confidence as the gel results for this isopod were clear and the quality score of the arthropod-specific gene being present was >30 at 46. Therefore, it is very clear this isopod does not have Wolbachia.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GGGGTTTGAGCAGGGGCTGTTGGAACTGCCCTTAGAATAATTATTCGCACTGATTTTTTGGTCACCCTGAAGTTTAATGGAGATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATGGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTGCTTAGAAGTGGGTTGGTTGAAAGAGGAGTAGGAACAGGATGGACAGTATATCCTCCGCTGGCGTCTAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTGAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTATTAGTAACGGCTGTACTTTTACTTTTATCCCTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGGGGAGGAGGAGACCCTATCCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGGNAAGTTTA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Isopoda was found to be negative for Wolbachia.
Report Inappropriate Post