Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/25/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | This isopod was collected near dry bushes in the morning (around 10 AM). There were a couple of its kind (around 3 others) in the surrounding area. |
| Putative identification | Arthropoda Malacostraca Isopoda |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | 1X TAE |
| DNA stain | 100X Fast Blast |
| Gel images |
|
| Protocol notes | *NOTE: Lanes are numbered when the gel image is clicked. DNA Stain We used an overnight stain and let it stain for approximately 24 hours. Gel Electrophoresis 10 microliters of sample were added per well for this 1% agarose gel. This is the lane order for the gel: 1. DNA Ladder 2. High Altitude Roly-Poly #1 (Palos Verdes) – this isopod. 3. High Altitude Roly-Poly #2 (Palos Verdes) 4. Low Altitude Roly-Poly #3 (CSUDH) 5. Low Altitude Roly-Poly #4 (CSUDH) 6. Positive Arthropod CO1F Gene Control 7. Negative Arthropod CO1F Gene Control 8. Positive DNA Control 9. Water |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | We present high confidence as there was a distinct band present in this lane for the arthropod-specific gene and nothing for the Wolbachia. |
| Wolbachia 16S sequence |
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
GGGGTTNGAGCAGGGGCTGTTGGAACTGCCCTTAGAATAATTATTCGCACTGAATTTTGACNACCTGNNAGTTTAAATGGAGATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATGGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTGCTTAGAAGTGGGTTGGTTGAAAGAGGAGTAGGAACAGGATGGACAGTATATCCTCCGCTGGCGTCTAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTGAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTATTAGTAACGGCTGTACTTTTACTTTTATCCCTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGGGGAGGAGGAGACCCTATCCTTTATCAACACTTATTTTGATTTTTTGGTCACC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Isopoda was found to be negative for Wolbachia. |


Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)
(no title)