Pill Bug GRP15

May 22, 2026

Sample information
Picture
Entry by: (No pictures of the arthropod were taken outside of the collection tube)
Location
Collection date 04/20/2026
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

I found this pill bug in a small garden inside the school under slightly damp soil. It was collected in a temperate environment during the spring at 11:42am. It was sunny, and about 70 degrees Fahrenheit. There were several pill bugs in the area, but I only collected one.
Putative identification Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare

Methods
Extraction kit QIAGEN DNeasy kit
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain uv
Gel images
Protocol notes

DNA Extraction: The entire body of the pill bug was crushed thoroughly.

Gel Electrophoresis Lanes for CO1 arthropod and Wolbachia PCR:

1- N/A

2- DNA Ladder

3- Pill Bug (sample)

4- Millipede (sample)

5- Wolbachia (+) control

6- Wolbachia (-) control

7- DNA (+)

8- Water

Analysis: The controls for this gel produced successful results, and the pill bug showed a single arthropod band.

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

Two gels were run including the pill bug extracted DNA. The first gel’s Wolbachia positive control was not successful, but the second gel’s controls were both functional. Additionally, there was only 1 arthropod band in both gels for the pill bug.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GGGGTTTGAGCAGGGGCTGTTGGAACTGCCCTTAGAATAATTATTCGCACTGAATTAGGACAACCTGGAAGTTTAATTGGAGATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATGGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTGCTTAGAAGTGGGTTGGTTGAAAGAGGAGTAGGAACAGGATGGACAGTATATCCTCCGCTGGCGTCTAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTGAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTATTAGTAACGGCTGTACTTTTACTTTTATCCCTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGGGGAGGAGGAGACCCTATCCTTTATCAACACTTATTTTGATTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Armadillidium vulgare was found to be negative for Wolbachia.
Report Inappropriate Post