Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/20/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | I found this pill bug in a small garden inside the school under slightly damp soil. It was collected in a temperate environment during the spring at 11:42am. It was sunny, and about 70 degrees Fahrenheit. There were several pill bugs in the area, but I only collected one. |
| Putative identification | Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare |
Methods |
|
| Extraction kit | QIAGEN DNeasy kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | agarose gel electrophoresis |
| Buffer | 1X TAE |
| DNA stain | uv |
| Gel images |
|
| Protocol notes | DNA Extraction: The entire body of the pill bug was crushed thoroughly. Gel Electrophoresis Lanes for CO1 arthropod and Wolbachia PCR: 1- N/A 2- DNA Ladder 3- Pill Bug (sample) 4- Millipede (sample) 5- Wolbachia (+) control 6- Wolbachia (-) control 7- DNA (+) 8- Water Analysis: The controls for this gel produced successful results, and the pill bug showed a single arthropod band. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Two gels were run including the pill bug extracted DNA. The first gel’s Wolbachia positive control was not successful, but the second gel’s controls were both functional. Additionally, there was only 1 arthropod band in both gels for the pill bug. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GGGGTTTGAGCAGGGGCTGTTGGAACTGCCCTTAGAATAATTATTCGCACTGAATTAGGACAACCTGGAAGTTTAATTGGAGATGACCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGGTTAATTCCATTAATACTAGGAGCCCCAGATATGGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTGCTTAGAAGTGGGTTGGTTGAAAGAGGAGTAGGAACAGGATGGACAGTATATCCTCCGCTGGCGTCTAGAATTGCTCATAGAGGAGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTGAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATTAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTATTAGTAACGGCTGTACTTTTACTTTTATCCCTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGGGGAGGAGGAGACCCTATCCTTTATCAACACTTATTTTGATTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Armadillidium vulgare was found to be negative for Wolbachia. |

Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)
(no title)