Armadillidium Vulgare GRP11 – Arthropod Male #2 (AM2) | Carson, California, 90746

Sample information

Picture

Entry by: NC, OS, AL, YL, CE, JP

Location

Collection date

04/22/2026

Captive / Cultivated?

Wild-caught

Group

California Academy of Mathematics and Science

Observations

Caught outside classroom around 9:00 am in bushes. This pill bug was slightly larger than average compared to other observed pill bugs.

Putative identification

Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare

Methods

Extraction kit

Edwards Buffer

DNA extraction location

Other

Single or Duplex PCR

Single Reaction

Gel electrophoresis system

agarose gel electrophoresis

Buffer

1X TAE

DNA stain

UView

Gel images

Protocol notes

Used UV Stain. UV light right after. 10 microliters of sample were added per well for this 1% agarose gel.

Lane order of left gel (left to right):

Well 1	Control (-)
	1 Band
Well 2	Ladder
	5 Bands
Well 3	Arthropod Sample 1 (Female)
	1 Band
Well 4	Arthropod Sample 2 (Male)
	Smearing
Well 5	Arthropod Sample 3 (Male) (THIS SAMPLE)
	Smearing & 1 Band
Well 6	DNA Control (+)
	1 Band
Well 7	Control (+)
	1 Band
Well 8	N/A
	N/A

Order of lanes of right gel (left to right):

Well 1	Control (-)
	No Bands
Well 2	Ladder
	5 Bands
Well 3	Arthropod Sample 1 (Female)
	Smeared Band
Well 4	Arthropod Sample 2 (Male)
	Smeared Band
Well 5	Arthropod Sample 3 (Male) (THIS SAMPLE)
	Smeared Band
Well 6	DNA Control (+)
	1 Band
Well 7	Control (+)
	1 Band
Well 8	N/A
	N/A

Results

Wolbachia presence

Unknown

Confidence level

Medium

Explanation of confidence level

On the gel to the left, we had analyzed our samples for arthropod positivity. In this gel, the AM2 sample was ran in well 5 and portrayed a correlating band to the arthropod controls in wells 1 and 6. With a clear band being visible for the AM2 sample in well 5, we are confident that the AM2 sample was an arthropod.

On the other hand, we are unsure of the Wolbachia positivity for the AM2 sample due to our results seen in the gel to the right. In this gel, the AM2 sample (Well 5) did not show any correlating bands with the Wolbachia positive control (Well 6). Additionally, Well 5 portrayed smearing throughout the gel, which is a large factor in lowering our confidence level. Since a band correlated to the positive control could not be identified but could identify smearing, we are relatively confident that we do not know the Wolbachia positivity of the AM2 sample but not completely sure of its negativity.

Wolbachia 16S sequence

N/A

BLAST at The Wolbachia Project BLAST at NCBI

Arthropod COI sequence

Download FASTA Download AB1

GAGCAGGGGCTGTTGGGACTGCCCTTAGAATAATTATTCGCACTGAATTAGGACAGCCTGGAAGTTTAATTGGAGATGATCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTCGGTAACTGGTTAATTCCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGGATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTACTTAGAAGGGGATTAGTTGAAAGAGGAGTAGGAACAGGGTGGACAGTATATCCTCCGCTGGCGTCGAGAATTGCTCACAGAGGTGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATCAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTAATAGTAACGGCTGTGCTTTTGCTTTTATCATTACCTGTACTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGCGGAGGTGGGGATCCTATCCTTTATCAACATTTATTCTGATTTTTTG

BLAST at The Wolbachia Project BLAST at NCBI

Summary

Report Inappropriate Post