Sample information |
|||||||||||||||||||||||||||||||||||||||||||||||||
| Picture |
|
||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | |||||||||||||||||||||||||||||||||||||||||||||||||
| Collection date | 04/22/2026 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Captive / Cultivated? | Wild-caught | ||||||||||||||||||||||||||||||||||||||||||||||||
| Group | California Academy of Mathematics and Science | ||||||||||||||||||||||||||||||||||||||||||||||||
| Observations | Caught outside classroom around 9:00 am in bushes. This pill bug was slightly larger than average compared to other observed pill bugs. |
||||||||||||||||||||||||||||||||||||||||||||||||
| Putative identification | Arthropoda Malacostraca Isopoda Armadillidae Armadillidium Armadillidium vulgare | ||||||||||||||||||||||||||||||||||||||||||||||||
Methods |
|||||||||||||||||||||||||||||||||||||||||||||||||
| Extraction kit | Edwards Buffer | ||||||||||||||||||||||||||||||||||||||||||||||||
| DNA extraction location | Other | ||||||||||||||||||||||||||||||||||||||||||||||||
| Single or Duplex PCR | Single Reaction | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gel electrophoresis system | agarose gel electrophoresis | ||||||||||||||||||||||||||||||||||||||||||||||||
| Buffer | 1X TAE | ||||||||||||||||||||||||||||||||||||||||||||||||
| DNA stain | UView | ||||||||||||||||||||||||||||||||||||||||||||||||
| Gel images |
|
||||||||||||||||||||||||||||||||||||||||||||||||
| Protocol notes | Used UV Stain. UV light right after. 10 microliters of sample were added per well for this 1% agarose gel. Lane order of left gel (left to right):
Order of lanes of right gel (left to right):
|
||||||||||||||||||||||||||||||||||||||||||||||||
Results |
|||||||||||||||||||||||||||||||||||||||||||||||||
| Wolbachia presence | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||
| Confidence level | Medium | ||||||||||||||||||||||||||||||||||||||||||||||||
| Explanation of confidence level | On the gel to the left, we had analyzed our samples for arthropod positivity. In this gel, the AM2 sample was ran in well 5 and portrayed a correlating band to the arthropod controls in wells 1 and 6. With a clear band being visible for the AM2 sample in well 5, we are confident that the AM2 sample was an arthropod. On the other hand, we are unsure of the Wolbachia positivity for the AM2 sample due to our results seen in the gel to the right. In this gel, the AM2 sample (Well 5) did not show any correlating bands with the Wolbachia positive control (Well 6). Additionally, Well 5 portrayed smearing throughout the gel, which is a large factor in lowering our confidence level. Since a band correlated to the positive control could not be identified but could identify smearing, we are relatively confident that we do not know the Wolbachia positivity of the AM2 sample but not completely sure of its negativity. |
||||||||||||||||||||||||||||||||||||||||||||||||
| Wolbachia 16S sequence |
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
||||||||||||||||||||||||||||||||||||||||||||||||
| Arthropod COI sequence | Download FASTA
Download AB1
GAGCAGGGGCTGTTGGGACTGCCCTTAGAATAATTATTCGCACTGAATTAGGACAGCCTGGAAGTTTAATTGGAGATGATCAGATTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTCGGTAACTGGTTAATTCCATTAATACTAGGAGCCCCAGATATAGCTTTTCCACGGATAAATAATATAAGATTTTGACTTTTACCCCCTTCTTTAACTTTATTACTTAGAAGGGGATTAGTTGAAAGAGGAGTAGGAACAGGGTGGACAGTATATCCTCCGCTGGCGTCGAGAATTGCTCACAGAGGTGCATCTGTAGATTTAGGTATTTTTTCTCTCCACCTTGCTGGAGCTTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACTATAATTAATATACGAGCAGCTGGAATCAGAATAGACCGTGTTCCTTTATTTGTTTGATCAGTAATAGTAACGGCTGTGCTTTTGCTTTTATCATTACCTGTACTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCTAGCGGAGGTGGGGATCCTATCCTTTATCAACATTTATTCTGATTTTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
||||||||||||||||||||||||||||||||||||||||||||||||
| Summary | |||||||||||||||||||||||||||||||||||||||||||||||||



Camponotus Pennsylvanicus
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug