Colonus sylvanus (Sylvan Jumping Spider, Wolbachia +)

Sample information

Picture
Entry by: Joe C.
Location
Approximate location: 40.62, -74.57
Collection date 06/02/2026
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

This specimen was caught in a carbon dioxide-producing trap — made with yeast, sugar, water, and dish soap — in a suburban forest area. The trap was placed on the ground at the end of a dirt trail, surrounded by forest on 3 sides. This trap was also somewhat close in proximity to a lake.

Putative identification Arthropoda Arachnida Araneae Salticidae Colonus Colonus sylvanus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

The experiment began with the extraction of DNA from the Colonus sylvanus. To confirm DNA presence, a nanodrop was used, and the nanodrop found a concentration of 126.8 ng/ul. PCR was performed to amplify the Arthropod and possible Wolbachia DNAs. Following PCR, gel electrophoresis (1% gel) was run at 100V(including 100bp ladder) to determine the success of the previous protocols and to show presence of the DNA. In the end, the experiment found that the Colonus sylvanus did have Wolbachia.

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

In the bottom half of the gel in lane 3, the gel showed a faint, yet visible band of Wolbachia DNA in the specimen. Furthermore, the arthropod-positive and Wolbachia-positive DNA control fragments appeared on the gel (Top & Bottom of gel, respectively, Lane 4), as well as the Colonus sylvanus arthropod DNA fragments (Top of gel, Lane 3), indicating that the protocols were correctly followed. As well as this, the sequenced Wolbachia DNA of the specimen matched exactly with multiple submissions when compared to the NCBI BLAST database.

Wolbachia 16S sequence Download FASTA   
CCCGCATCCTTAGGTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGGCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGAGCTGCAAAGTCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATGGGAATTGGTTTCACTCGAAGCTA
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA   
AGCATGAGCTGCTATAGTAGGAACAGCGATAAGAGTATCAATTCGAATAGAATTAGGACAGTTAGGAAGATTTTTAGGAAATGATCATATATATAATGTTATTGTTACTGCTCATGCATTTGTTATAATTTTTTTTATAGTTATACCTATTTTAATTGGGGGATTTGGGAATTGATTGGTACCATTAATATTAGGAGCTCCTGATATAGCGTTTCCTCGAATAAATAATTTGAGATTTTGATTATTACCACCTTCTTTATTATTATTATTTATTTCTTCGTTATCTGAAATAGGAGTTGGGGCAGGGTGGACTGTTTATCCTCCATTAGCTTCTGTAGTGGGACATAATGGAAGTTCTGTTGATTTTGCTATTTTTTCTTTACATTTAGCTGGTGCTTCTTCTATTATAGGAGCTATTAATTTTATTTCTACTGTAATTAACATGCGTTCTGTAGGAATAAGAATGGAAAAGGTTCCTTTATTTGTCTGATCTGTAGTAATTACTGCTGTTTTATTATTATTATCTCTTCCTGTTTTAGCGGGAGCTATTACTATATTGTTGACTGATCGAAATTTTAATACTTCGTTTTTTGATCCTGCTGGTGGAGGGGATCCTATTTTATTTCAACATTTATTTTGATTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Colonus sylvanus was found to be postive for Wolbachia.
Report Inappropriate Post