Eudioctria albius (Robber Fly, Wolbachia -)

Sample information

Picture
Entry by: Alan H
Location
Approximate location: 40.62, -74.57
Collection date 05/25/2026
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

Caught with tweezers on a hiking trail on the Pingry School Basking Ridge campus, flying low and landing on the ground. The ground was decently wet, having just rained a day ago.

Putative identification Arthropoda Insecta Diptera Asilidae Eudioctria Eudioctria albius

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Specimen 1 was collected and its DNA extracted using the DNeasy protocol. Two PCR reactions were run on the extracted DNA. The first used COI primers to amplify a region of the arthropod cytochrome oxidase I gene (~708 bp), confirming that intact arthropod DNA was present. The second used Wolbachia primers (~438 bp) to test for the bacteria. Each reaction included a positive control and a water negative control. Products were run on an 1% agarose gel (100V) with a 100bp DNA ladder and visualized under UV to compare band sizes against the controls.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

In the gel, the COI and Wolbachia samples were loaded into the top and bottom wells, respectively. The COI reaction in lane 2 produced a band at ~708 bp matching the positive control, confirming the extracted arthropod DNA was present. The positive control amplified cleanly at ~438 bp for Wolbachia (proving the primers and reaction worked), and the water negative control stayed clear (ruling out contamination). Knowing the PCR reaction worked, we know the absence of a band on the bottom well for lane 2 is a negative for Wolbachia.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AATTCGAACTGAACTTGGCCACCCTGGATCTCTTATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCCCACGCAT TTGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTTCCCTTAATATTAGGAGCC CCTGATATAGCATTCCCACGAATAAATAACATAAGATTTTGACTATTGCCTCCGTCTCTTACTCTTCTACTCGCTAGTAG TATAGTTGAAAATGGAGCTGGAACAGGATGAACAGTATACCCCCCTCTTTCATCAAGAATTGCCCATAGAGGATCGTCTG TTGACTTAGCAATTTTTTCTCTTCACCTTGCCGGAATCTCGTCAATTTTAGGGGCAGTTAATTTTATTACTACCATTATT AATATACGATCAATTGGAATCACATTTGACCGTATACCCCTATTTGTTTGATCAGTTATAATCACTGCAATTCTTCTATT ACTATCATTACCAGTATTAGCAGGAGCTATTACAATATTATTAACTGACCGAAATTTAAACACTTCTTTCTTTGACCCTG CAGGAGGTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Eudioctria albius was found to be negative for Wolbachia.
Report Inappropriate Post