Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/26/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Brown-black, 6 legs, winged, ant-shaped, has antennae, about the size of a grain of rice. Found right outside the woods behind The Pingry School, Basking Ridge, NJ, outside the walking path. |
| Putative identification | Arthropoda |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | 1X Agarose Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR-SAFE |
| Gel images |
|
| Protocol notes | First, DNA extraction was conducted with a DNEasy Qiagen Kit. Then, PCR was done for COI and for Wolbachia with COI and Wolbachia primers. Then, 1% gel with a 100bp ladder was run, and the PCR was purified with a QIAquick kit and then sequenced. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The gel results indicate that Wolbachia is not present in the ant, as lane 3 in the Wolbachia gel shows no bands. Confidence level is high, as all controls worked, and arthropod DNA was present in the bug in lane 3 of the arthropod gel. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TGGGTCCTCTATAAGTATAATTATTCGTTTAGAATTAGGATCTCCAAATGCTTTAATTAATAATGATCAAATTTATAATTCCATAGTTACTAGACATGCTTTCATTATAATTTTCTTCATAGTAATGCCTTTTATAATTGGTGGATTCGGGAATTTTTTAGTTCCATTAATACTTGGGTCCCCTGATATAGCTTATCCCCGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCCTTATCATTACTTTTATTAAGAAATTTTATTAATGATGGAGTCGGAACAGGTTGAACAGTTTATCCCCCTTTAGCATCTAATATTTTTCATAATGGCCCCTCAGTTGATCTTGCTATTTTTTCTTTACATATTGCTGGGATATCCTCAATTCTAGGGGCTATTAATTTTATTTCTACTATTCTAAATATACATCATAAAAATTTTTCAATTGATAAAATTCCCCTTCTTGTTTGATCTATCCTAATTACAGCAATTCTTCTTCTTTTATCATTACCAGTACTAGCTGGAGCAATCACTATGTTATTGACAGATCGTAATTTAAATACCTCTTTTTTCGATCCCTCTGGGGGGGGTGATCCAATCCTTTACCAACACTTATTCTGATTTTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Arthropoda was found to be negative for Wolbachia. |


Camponotus Pennsylvanicus
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug