Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 03/07/2024 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | Habitat -> under the bark of a fir tree |
Putative identification | Arthropoda Myriapoda Diplopoda Polydesmida Polydesmidae Polydesmus Polydesmus angustus |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Rear half |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
|
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | Medium |
Explanation of confidence level | |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
CTATAAGAGGTTTTATTCGTTTGGAGTTGGGTGTTCCTGGAAGTTTCATAGGGGATGATCATATTTTTAATGTAGTTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATG
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Polydesmus angustus was found to be negative for Wolbachia. |