Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Ontholestes SP found under dead leaves, motionless until provoked, attempted to burrow underground. Three-segmented beetle, found with one pincer missing, shiny black hard abdomen section, six legs. Yellow and brown striped patterns across abdomen and lower areas, abdomen about 3 centimeters, full body about 6 centimeters in length, pointed middle segment and “tail” like 2mm appendages at end of abdomen. |
| Putative identification | Arthropoda Insecta Coleoptera Staphylinidae Ontholestes |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Ontholestes SP was identified using the SEEK app and taxonomic methods of identification. Wolbachia-rich sections of the beetle’s guts were removed from the abdomen by squeezing the abdomen. The DNA in this section was then extracted and eluted. The gel was divided into two parts: the upper section of the gel contained results to confirm or deny the presence of Arthropoda gene CO1, while the lower section confirmed and denies presence of Wolbachia genes. both sections used positive and negative controls, DNA controls, and water controls, most of which worked properly. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | The controls in the gel worked correctly except for the water control (suspected contamination). When blasting Arthropoda sequence, many species were identified as identical matches to the sequence, leading to a lower confidence level, thus this species will only be identified as Ontholestes. |
| Wolbachia 16S sequence |
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
GGAATAGTAGGAACTTCCCTCAGTCTACTTATTCGAGCCGAACTTGGAAACCCTGGAACCTTAATTGGTGATGATCAAATTTATAACGTTATTGTTACAGCTCATGCATTTGTAATAATTTTCTTCATGGTAATACCAATTGTTATTGGTGGATTTGGAAATTGACTAGTACCCTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGACTTTTACCCCCTTCTCTAACTCTTCTCTTAATAAGAAGAATAGCTGAAAGAGGGGCCGGAACTGGATGAACCGTTTACCCCCCTCTTTCAGCTAATGTGGCCCATAGAGGAGCTTCGGTTGATTTAGCTATTTTTAGATTACACTTAGCTGGTATCTCATCAATTCTTGGCGCAGTAAACTTTATTACTACAGTAATCAATATACGATCCACAGGAATAACATTTGATCGAATACCATTATTTGTTTGATCGGTAAGAATTACAGCTCTATTGCTTCTTTTATCCTTACCAGTTTTAGCAGGTGCTATCACTATGCTTTTAACTGATCGGAATTTAAATACAACATTTTTTGACCCTGCTGGTGGAGGAGACCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Ontholestes was found to be negative for Wolbachia. |



Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft