Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/27/2020 |
| Captive / Cultivated? | Wild-caught |
| Group | St. Albans School |
| Observations | I found this ladybug larvae on the front porch of my home underneath a light. It was the only one nearby. |
| Putative identification | Arthropoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | There was no band which matched the control band in the gel. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Harmonia axyridis was found to be negative for Wolbachia. |
Common Eastern Bumble Bee (Bombus impatiens)
American Bird
Spotted crane fly
Wolbachia data
Meadow Katydid