B-6-Agriphila ruricolella

Sample information

Picture
Photos by: Lucas S
Location
Collection date 09/22/2024
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

This arthropod seems to be a small moth. It was quite small, but when it was flying around, it had a larger appearance. I was able to catch it right after it died. I caught it in a bedroom in a house. It was a very bright space, so it makes sense that the moth would be attracted to the light. It was an urban environment, 75f, and the season was fall.

Putative identification Arthropoda Insecta Lepidoptera

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction

  1. The DNA extraction went well for the most part. The only issues of note are that we added about 50ul of extra Buffer to B-2, B-3, and B-5. We also spilled a little bit of B-5.

PCR”:

  1. There was one notable mistake during the PCR, we forgot to switch pipette tips between samples possibly contaminating them.

Gel electrophoresis, Arthropod CO1

  1. The ladder was marked on all Gels
  2. Samples B-1 through B-6 were positive for arthropod DNA
  3. The positive and negative controls were also marked positive, and water was marked negative

Gel electrophoresis, Wolbachia

  1. B-1 through B-5 were negative and B-6 was positive
  2. The controls worked with both negative and water controls marked negative, and the positive control marked positive
  3. There were no notable mistakes or errors

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

B6 is a clear outlier to all the other arthropods. There is a clear, glowing box under B6. There were no errors in this gel. The positive control came back positive, and the negative control was negative. We know that the gel was flawless, but the pipette tips were not changed for B2, B3, B4, B5, and B6, so there may have been some contamination; however, its effects were minuscule since the gels ran well.

Wolbachia 16S sequence Download FASTA    Download AB1
NNNNNNNNNNnGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTA AGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACG TGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTA CTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTT GTACACACTGCCCGTCACnN
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
nAGTAGGAACATCCCTAAGATTACTAATTCGTGCTGAATTAGGAACCCCCGGATCTTTAATTGGTGATGATCAAATTTAT AATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTG ATTAGTTCCATTAATACTAGGAGCACCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTATTGCCTCCCT CTTTAACCTTATTAATTTCTAGAAGAATTGTAGAAAATGGGGCTGGAACAGGATGAACAGTATACCCCCCCCTTTCATCT AATATTGCTCACAGAGGAAGATCTGTAGACTTAGCTATTTTTTCCCTACACTTAGCAGGAATTTCTTCAATTCTAGGAGC AATTAATTTTATTACAACTATTATTAACATACGAATTAATGGATTATCTTTTGATCAAATACCTTTATTTGTTTGATCTG TTGGAATTACAGCTTTACTTCTTCTCCTATCATTACCAGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAAT CTTAATACTTCTTTTTTn
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lepidoptera was found to be postive for Wolbachia.
Report Inappropriate Post