Wolbachia-negative Trialeurodes vaporariorum

May 7, 2025

Sample information
Picture
Photos by: Zachary L.
Location
Collection date 04/01/2025
Captive / Cultivated? Wild-caught
Group College of Eastern Idaho
Observations

Was found inhabiting a lemon tree in a residential suburban environment. Found and captured in egg stage.
Putative identification Arthropoda Insecta Hemiptera Aleyrodidae Trialeurodes Trialeurodes vaporariorum

Methods
Extraction kit Edwards Buffer
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain GelGreen
Gel images
Protocol notes

The Trialeurodes vaporariorum tests are located in the bottom gel, rightmost column, second and sixth rows (WspecF and CO1, respectively). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation.

Results
Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Since the ab1 file shows clear contamination, and there are no controls, I can only be somewhat confident that the PCR the DNA has undergone is working. However, contamination would not be able to induce a false negative into a sample, and as such, I am still somewhat confident in this result.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
ATGTTCTTGTAACTTCCCATGCATTTATTATAATTTTTTTTATGACTATGCCTCTTGTTATTGGTGGGTTCGGGAACTGGCTGGTTCCTCTTATGGTTGGGGCTCCTGATATGGCGTTTCCTCCAATAAATAATCTTAGATTTTGGCTGTTGNTTCCTTCTTTGTTTTTTATGCTTGTTAGACTTTTGATTGATAGGGGAAGCGGCACGGGTTGAACTGTTTATCCCCCCCTATCTATAAGGCTGTCACATAGGGGGAATTCTGTCGATTTTTCTATTATNTCTTTGCACGTTGCTGGAATTTCTTCTATTTTGGGATCACTTAATTTTATCCTGACTATTGTAAACATGCAGGCGTTGGGCATAAAAATGGAGTTTTAATCTTTGTTTGTCTGATCTGTGTTTATTACTGTTTTCTTGCTTTTAATTTCTCTTCCTGTGTGGGCAGGGGCAATTACTATACTTTTACTGGATNGTAATTTTAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Trialeurodes vaporariorum was found to be negative for Wolbachia.
Report Inappropriate Post