Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/30/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | This arthropod had a very large abdomen compared to our other samples. |
| Putative identification | Arthropoda Arachnida Araneae Dysderidae Dysdera Dysdera crocata |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system Bio-Rad |
| Buffer | 1X TAE |
| DNA stain | UView |
| Gel images |
|
| Protocol notes | Gel 1 Gel 2 Our first gel’s ladder did not run successfully, so we ran another gel with the same ladder and and another MiniOne ladder and compared the relative mobilities of the two gels to determine the base pairs of the first gel. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Although our controls worked, we are unsure of why our ladder did not run, so the results of our gel are somewhat questionable. However, all of the samples ran correctly, with aligned bands that were only in expected locations. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
NNNNNNNNNNNNNNNTNGNTNGCTTGGTCTGCTATAGTGGGTACAGCAATAAGAGTCTTAATTCGGGCGGAGTTGGGTCA GGTTGGAAGATTATTGGGTGATGATCATTTGTTTAATGTGGTGGTTACAGCGCATGCTTTAGTTATGATTTTTTTTATAG TAATACCTATTATAATTGGAGGATTTGGTAATTGGTTAGTGCCTTTGATGCTTGGAGCTCCTGATATGGCTTTTCCTCGT ATGAATAATTTAAGTTTTTGGTTGTTGCCTCCTTCTTTAATTTTATTAGTTATTTCTTCGATAGTGGAAATAGGGGTGGG GGCTGGGTGAACGATTTATCCCCCCTTGTCAGGGGCATTAGGGCATGCCGGAGTGTCGGTAGATTTAGCTATTTTTAGCT TGCATTTAGCTGGGGCTTCTTCTATTATGGGGGCAATTAATTTTATTTCTACAATTTTGAATATGCGGTCTGAGGGAATA TCTTTGGATAAGGTACCTTTGTTTGTGTGATCTGTTTTGGTAACGGCTGTTTTGTTATTGTTGTCGTTGCCAGTTTTAGC TGGGGCGATTACTATGCTATTAACGGATCGGAATTTTAATACATCTTTTTTTGACCCAGCGGGAGGAGGGGATCCTATTT TGTTTCAACATTTATTTTGATTTTTTGGTCACCNGNNAAGTTNN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Dysdera crocata was found to be negative for Wolbachia. |



Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft