Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/18/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | St. Paul Academy and Summit School |
| Observations | Small, black, ant-looking, has 6 legs and three segments(head, abdomen, head), most likely has antennas but is a bit crushed. The bug has no wings. Caught in the SPA courtyard during fall, it was about 70 degrees F. The courtyard is grassy and open. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Tetramorium Tetramorium forceps |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | SeeGreen |
| Gel images |
|
| Protocol notes | My results were in lane 5. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | My testing for Wolbachia worked from start to end and had many different controls that worked. From this, I know that the process worked and the results are fine. However, during my DNA sequence analysis, the Q values were very low, so my DNA sequence may not be correct. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
NNNNNNTAAGTATAATTATTCGACTAGAATTAGGATCATGTATTTCTTTAATTAATAATGATCAAATTTATAATATCCTA GTAACAAGCCNTGCTTTTATTTTAATTTTTTTTATACTAATGCTTTTTATAATCGGGGGATTTGGAAATTTTTTATTTCC TTTAATACTAGGAACTCCAGATATACCTTACCCCAAAAAAAAAAAAAAAAAATTTGACCTCCCCCCCCATCTATTAAAAT TATTTTAGTTAAAAAATTTTATAATTCCGGGGTTGGGATGGGGNAACTATCCACCCTCCCCTACTACCTATTTTTCCTCA GGGACCATCAATTACCCTTCAAATTTTTTCCCCTNTTTTGCTGAAAATTTTTTCTTTTTAAGAGACAAAAATTTTTTTTT TTCCCTCCTCAATTAACCCCATTTAAAACTAAACCTACGT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Tetramorium forceps was found to be negative for Wolbachia. |


Common Eastern Bumble Bee (Bombus impatiens)
American Bird
Spotted crane fly
Wolbachia data
Meadow Katydid