Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2025 students. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Formica Formica pallidefulva |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | High |
| Explanation of confidence level | I am confident in it after the gel was ran professionally the second time. At first, I did not notice any Wolbachia due to it being not too clear. The second time it was ran, Wolbachia came back and I had found out what it was. I also had a 100% ID match once it was ran. |
| Wolbachia 16S sequence |
GAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
GATATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCCATCACTCTATTACTTT TAAGAAACTTTATTAATGATGGTACTGGAACTGGATGAACTATCTATCCTCCTTTAGCTTCAAATATTTT TCATAATGGACCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCCGGTATATCATCTATTTTAGGA GCTATTAATTTTATTTCAACAATTCTAT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Formica pallidefulva was found to be postive for Wolbachia. |


ROM-JNM
CHI-KFB Diptera
BRI-MAO COLEOPTERA
BRI-AMM Hemiptera