Lacewing GRP14

Sample information

Picture
Entry by: Kaylynn S.
Location
Collection date 04/29/2026
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

Sighted under a leaf of a pomegranate tree, where there was a cocoon, and seemed attracted to the flashlight.

Putative identification Arthropoda Insecta Neuroptera Chrysopidae

Methods

Extraction kit Edwards Buffer
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain UView
Gel images
Protocol notes

DNA Extraction Protocol

Gel Electrophoresis Protocol

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Based on the reuslts from gel electrophoresis, once put on a UV lightbox our ladder appeared and there was one band present on the lane in which we loaded the lacewing sample. That one band had the same amount of base pairs an arthropod would have, which was obtained by the ladder. So, due to this we concluded that it was an arthropod and not wolbachia infected.

Wolbachia 16S sequence Download FASTA   
Arthropod COI sequence Download FASTA    Download AB1
5' GCCCTTAGAATAATTATTCGCACTGATTTTTTGGTCACCCTGAAGTTTAA 3'
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Chrysopidae was found to be negative for Wolbachia.
Report Inappropriate Post